diff options
Diffstat (limited to 'pod/perlretut.pod')
| -rw-r--r-- | pod/perlretut.pod | 2 |
1 files changed, 1 insertions, 1 deletions
diff --git a/pod/perlretut.pod b/pod/perlretut.pod index cc8f5c4c9b..65dfb4782c 100644 --- a/pod/perlretut.pod +++ b/pod/perlretut.pod @@ -1415,7 +1415,7 @@ naive regexp $dna = "ATCGTTGAATGCAAATGACATGAC"; $dna =~ /TGA/; -doesn't work; it may match an C<TGA>, but there is no guarantee that +doesn't work; it may match a C<TGA>, but there is no guarantee that the match is aligned with codon boundaries, e.g., the substring S<C<GTT GAA> > gives a match. A better solution is |