diff options
author | ian <ian@138bc75d-0d04-0410-961f-82ee72b054a4> | 2012-01-25 00:04:13 +0000 |
---|---|---|
committer | ian <ian@138bc75d-0d04-0410-961f-82ee72b054a4> | 2012-01-25 00:04:13 +0000 |
commit | 8abebcd5f7f2e01ef5c175f95abd19facfdbc15b (patch) | |
tree | f820710fc010727fffa668d2cfa5067bddb1109f /gcc/testsuite/go.test/test | |
parent | dc619250adc07b45a516ad78135980a021bfcd95 (diff) | |
download | gcc-8abebcd5f7f2e01ef5c175f95abd19facfdbc15b.tar.gz |
Update to current Go testsuite.
* go.test/go-test.exp (filecmp): New procedure.
(errchk): Handle quoted square brackets.
(go-gc-tests): Set go_compile_args. Handle various new test
lines. Skip a few new tests.
* lib/go-torture.exp (go-torture-execute): Use go_compile_args.
git-svn-id: svn+ssh://gcc.gnu.org/svn/gcc/trunk@183502 138bc75d-0d04-0410-961f-82ee72b054a4
Diffstat (limited to 'gcc/testsuite/go.test/test')
231 files changed, 8948 insertions, 1152 deletions
diff --git a/gcc/testsuite/go.test/test/alias.go b/gcc/testsuite/go.test/test/alias.go new file mode 100644 index 00000000000..639a9cabbb4 --- /dev/null +++ b/gcc/testsuite/go.test/test/alias.go @@ -0,0 +1,32 @@ +// errchk $G -e $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package main + +// Test that error messages say what the source file says +// (uint8 vs byte, int32 vs. rune). + +import ( + "fmt" + "unicode/utf8" +) + +func f(byte) {} +func g(uint8) {} + +func main() { + var x float64 + f(x) // ERROR "byte" + g(x) // ERROR "uint8" + + // Test across imports. + + var ff fmt.Formatter + var fs fmt.State + ff.Format(fs, x) // ERROR "rune" + + utf8.RuneStart(x) // ERROR "byte" +} diff --git a/gcc/testsuite/go.test/test/alias1.go b/gcc/testsuite/go.test/test/alias1.go new file mode 100644 index 00000000000..e8ef8a23f96 --- /dev/null +++ b/gcc/testsuite/go.test/test/alias1.go @@ -0,0 +1,54 @@ +// $G $D/$F.go && $L $F.$A && ./$A.out + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package main + +// Test that dynamic interface checks treat byte=uint8 +// and rune=int or rune=int32. + +func main() { + var x interface{} + + x = byte(1) + switch x.(type) { + case uint8: + // ok + default: + println("byte != uint8") + } + + x = uint8(2) + switch x.(type) { + case byte: + // ok + default: + println("uint8 != byte") + } + + rune32 := false + x = rune(3) + switch x.(type) { + case int: + // ok + case int32: + // must be new code + rune32 = true + default: + println("rune != int and rune != int32") + } + + if rune32 { + x = int32(4) + } else { + x = int(5) + } + switch x.(type) { + case rune: + // ok + default: + println("int (or int32) != rune") + } +} diff --git a/gcc/testsuite/go.test/test/append.go b/gcc/testsuite/go.test/test/append.go index 96421c36b89..e178f46990d 100644 --- a/gcc/testsuite/go.test/test/append.go +++ b/gcc/testsuite/go.test/test/append.go @@ -63,6 +63,11 @@ var tests = []struct { {"byte i", append([]byte{0, 1, 2}, []byte{3}...), []byte{0, 1, 2, 3}}, {"byte j", append([]byte{0, 1, 2}, []byte{3, 4, 5}...), []byte{0, 1, 2, 3, 4, 5}}, + {"bytestr a", append([]byte{}, "0"...), []byte("0")}, + {"bytestr b", append([]byte{}, "0123"...), []byte("0123")}, + + {"bytestr c", append([]byte("012"), "3"...), []byte("0123")}, + {"bytestr d", append([]byte("012"), "345"...), []byte("012345")}, {"int16 a", append([]int16{}), []int16{}}, {"int16 b", append([]int16{}, 0), []int16{0}}, diff --git a/gcc/testsuite/go.test/test/garbage/Makefile b/gcc/testsuite/go.test/test/bench/garbage/Makefile index e8338438265..8002a2017bc 100644 --- a/gcc/testsuite/go.test/test/garbage/Makefile +++ b/gcc/testsuite/go.test/test/bench/garbage/Makefile @@ -2,23 +2,24 @@ # Use of this source code is governed by a BSD-style # license that can be found in the LICENSE file. -include ../../src/Make.inc +include ../../../src/Make.inc ALL=\ parser\ peano\ tree\ + tree2\ all: $(addsuffix .out, $(ALL)) %.$O: %.go stats.go - $(GC) $*.go stats.go + $(GC) $(GCFLAGS) $(GCIMPORTS) $*.go stats.go %.out: %.$O $(LD) -o $@ $*.$O %.bench: %.out - ./$*.out + time ./$*.out bench: $(addsuffix .bench, $(ALL)) diff --git a/gcc/testsuite/go.test/test/garbage/parser.go b/gcc/testsuite/go.test/test/bench/garbage/parser.go index 19a96bc63bd..9e15f6c0f4d 100644 --- a/gcc/testsuite/go.test/test/garbage/parser.go +++ b/gcc/testsuite/go.test/test/bench/garbage/parser.go @@ -12,27 +12,27 @@ import ( "go/ast" "go/parser" "go/token" + "log" + "net/http" + _ "net/http/pprof" "os" "path" "runtime" "strings" "time" - "http" - _ "http/pprof" - "log" ) var serve = flag.String("serve", "", "serve http on this address at end") -func isGoFile(dir *os.FileInfo) bool { - return dir.IsRegular() && - !strings.HasPrefix(dir.Name, ".") && // ignore .files - path.Ext(dir.Name) == ".go" +func isGoFile(dir os.FileInfo) bool { + return !dir.IsDir() && + !strings.HasPrefix(dir.Name(), ".") && // ignore .files + path.Ext(dir.Name()) == ".go" } -func isPkgFile(dir *os.FileInfo) bool { +func isPkgFile(dir os.FileInfo) bool { return isGoFile(dir) && - !strings.HasSuffix(dir.Name, "_test.go") // ignore test files + !strings.HasSuffix(dir.Name(), "_test.go") // ignore test files } func pkgName(filename string) string { @@ -49,7 +49,7 @@ func parseDir(dirpath string) map[string]*ast.Package { _, pkgname := path.Split(dirpath) // filter function to select the desired .go files - filter := func(d *os.FileInfo) bool { + filter := func(d os.FileInfo) bool { if isPkgFile(d) { // Some directories contain main packages: Only accept // files that belong to the expected package so that @@ -57,7 +57,7 @@ func parseDir(dirpath string) map[string]*ast.Package { // found" errors. // Additionally, accept the special package name // fakePkgName if we are looking at cmd documentation. - name := pkgName(dirpath + "/" + d.Name) + name := pkgName(dirpath + "/" + d.Name()) return name == pkgname } return false @@ -66,17 +66,13 @@ func parseDir(dirpath string) map[string]*ast.Package { // get package AST pkgs, err := parser.ParseDir(token.NewFileSet(), dirpath, filter, parser.ParseComments) if err != nil { - println("parse", dirpath, err.String()) + println("parse", dirpath, err.Error()) panic("fail") } return pkgs } func main() { - runtime.GOMAXPROCS(4) - go func() {}() - go func() {}() - go func() {}() st := &runtime.MemStats packages = append(packages, packages...) packages = append(packages, packages...) @@ -86,7 +82,7 @@ func main() { flag.Parse() var lastParsed []map[string]*ast.Package - var t0 int64 + var t0 time.Time pkgroot := runtime.GOROOT() + "/src/pkg/" for pass := 0; pass < 2; pass++ { // Once the heap is grown to full size, reset counters. @@ -95,7 +91,7 @@ func main() { // the average look much better than it actually is. st.NumGC = 0 st.PauseTotalNs = 0 - t0 = time.Nanoseconds() + t0 = time.Now() for i := 0; i < *n; i++ { parsed := make([]map[string]*ast.Package, *p) @@ -109,7 +105,7 @@ func main() { runtime.GC() runtime.GC() } - t1 := time.Nanoseconds() + t1 := time.Now() fmt.Printf("Alloc=%d/%d Heap=%d Mallocs=%d PauseTime=%.3f/%d = %.3f\n", st.Alloc, st.TotalAlloc, @@ -124,7 +120,7 @@ func main() { } */ // Standard gotest benchmark output, collected by build dashboard. - gcstats("BenchmarkParser", *n, t1-t0) + gcstats("BenchmarkParser", *n, t1.Sub(t0)) if *serve != "" { log.Fatal(http.ListenAndServe(*serve, nil)) @@ -132,23 +128,20 @@ func main() { } } - var packages = []string{ "archive/tar", - "asn1", - "big", + "encoding/asn1", + "math/big", "bufio", "bytes", - "cmath", + "math/cmplx", "compress/flate", "compress/gzip", "compress/zlib", "container/heap", "container/list", "container/ring", - "container/vector", "crypto/aes", - "crypto/block", "crypto/blowfish", "crypto/hmac", "crypto/md4", @@ -167,20 +160,14 @@ var packages = []string{ "debug/macho", "debug/elf", "debug/gosym", - "debug/proc", - "ebnf", + "exp/ebnf", "encoding/ascii85", "encoding/base64", "encoding/binary", "encoding/git85", "encoding/hex", "encoding/pem", - "exec", - "exp/datafmt", - "exp/draw", - "exp/eval", - "exp/iterable", - "expvar", + "os/exec", "flag", "fmt", "go/ast", @@ -189,18 +176,18 @@ var packages = []string{ "go/printer", "go/scanner", "go/token", - "gob", + "encoding/gob", "hash", "hash/adler32", "hash/crc32", "hash/crc64", - "http", + "net/http", "image", "image/jpeg", "image/png", "io", "io/ioutil", - "json", + "encoding/json", "log", "math", "mime", @@ -209,29 +196,29 @@ var packages = []string{ "os/signal", "patch", "path", - "rand", + "math/rand", "reflect", "regexp", - "rpc", + "net/rpc", "runtime", - "scanner", + "text/scanner", "sort", - "smtp", + "net/smtp", "strconv", "strings", "sync", "syscall", - "syslog", - "tabwriter", - "template", + "log/syslog", + "text/tabwriter", + "text/template", "testing", "testing/iotest", "testing/quick", "testing/script", "time", "unicode", - "utf8", - "utf16", + "unicode/utf8", + "unicode/utf16", "websocket", - "xml", + "encoding/xml", } diff --git a/gcc/testsuite/go.test/test/garbage/peano.go b/gcc/testsuite/go.test/test/bench/garbage/peano.go index b4d31856126..f1ad6ed699c 100644 --- a/gcc/testsuite/go.test/test/garbage/peano.go +++ b/gcc/testsuite/go.test/test/bench/garbage/peano.go @@ -12,31 +12,25 @@ import ( "time" ) - type Number struct { next *Number } - // ------------------------------------- // Peano primitives func zero() *Number { return nil } - func is_zero(x *Number) bool { return x == nil } - func add1(x *Number) *Number { e := new(Number) e.next = x return e } - func sub1(x *Number) *Number { return x.next } - func add(x, y *Number) *Number { if is_zero(y) { return x @@ -45,7 +39,6 @@ func add(x, y *Number) *Number { return add(add1(x), sub1(y)) } - func mul(x, y *Number) *Number { if is_zero(x) || is_zero(y) { return zero() @@ -54,7 +47,6 @@ func mul(x, y *Number) *Number { return add(mul(x, sub1(y)), x) } - func fact(n *Number) *Number { if is_zero(n) { return add1(zero()) @@ -63,7 +55,6 @@ func fact(n *Number) *Number { return mul(fact(sub1(n)), n) } - // ------------------------------------- // Helpers to generate/count Peano integers @@ -75,7 +66,6 @@ func gen(n int) *Number { return zero() } - func count(x *Number) int { if is_zero(x) { return 0 @@ -84,7 +74,6 @@ func count(x *Number) int { return count(sub1(x)) + 1 } - func check(x *Number, expected int) { var c = count(x) if c != expected { @@ -92,7 +81,6 @@ func check(x *Number, expected int) { } } - // ------------------------------------- // Test basic functionality @@ -117,19 +105,17 @@ func verify() { check(fact(gen(5)), 120) } - // ------------------------------------- // Factorial - func main() { - t0 := time.Nanoseconds() + t0 := time.Now() verify() for i := 0; i <= 9; i++ { print(i, "! = ", count(fact(gen(i))), "\n") } runtime.GC() - t1 := time.Nanoseconds() + t1 := time.Now() - gcstats("BenchmarkPeano", 1, t1-t0) + gcstats("BenchmarkPeano", 1, t1.Sub(t0)) } diff --git a/gcc/testsuite/go.test/test/garbage/stats.go b/gcc/testsuite/go.test/test/bench/garbage/stats.go index 474e6ad4abc..985e7eaf5dc 100644 --- a/gcc/testsuite/go.test/test/garbage/stats.go +++ b/gcc/testsuite/go.test/test/bench/garbage/stats.go @@ -8,12 +8,13 @@ import ( "fmt" "runtime" "sort" + "time" ) -func gcstats(name string, n int, t int64) { +func gcstats(name string, n int, t time.Duration) { st := &runtime.MemStats fmt.Printf("garbage.%sMem Alloc=%d/%d Heap=%d NextGC=%d Mallocs=%d\n", name, st.Alloc, st.TotalAlloc, st.Sys, st.NextGC, st.Mallocs) - fmt.Printf("garbage.%s %d %d ns/op\n", name, n, t/int64(n)) + fmt.Printf("garbage.%s %d %d ns/op\n", name, n, t.Nanoseconds()/int64(n)) fmt.Printf("garbage.%sLastPause 1 %d ns/op\n", name, st.PauseNs[(st.NumGC-1)%uint32(len(st.PauseNs))]) fmt.Printf("garbage.%sPause %d %d ns/op\n", name, st.NumGC, int64(st.PauseTotalNs)/int64(st.NumGC)) nn := int(st.NumGC) @@ -22,13 +23,14 @@ func gcstats(name string, n int, t int64) { } t1, t2, t3, t4, t5 := tukey5(st.PauseNs[0:nn]) fmt.Printf("garbage.%sPause5: %d %d %d %d %d\n", name, t1, t2, t3, t4, t5) - -// fmt.Printf("garbage.%sScan: %v\n", name, st.ScanDist) + + // fmt.Printf("garbage.%sScan: %v\n", name, st.ScanDist) } type T []uint64 -func (t T) Len() int { return len(t) } -func (t T) Swap(i, j int) { t[i], t[j] = t[j], t[i] } + +func (t T) Len() int { return len(t) } +func (t T) Swap(i, j int) { t[i], t[j] = t[j], t[i] } func (t T) Less(i, j int) bool { return t[i] < t[j] } func tukey5(raw []uint64) (lo, q1, q2, q3, hi uint64) { diff --git a/gcc/testsuite/go.test/test/garbage/tree.go b/gcc/testsuite/go.test/test/bench/garbage/tree.go index c5eae9760f2..0a3ec234db8 100644 --- a/gcc/testsuite/go.test/test/garbage/tree.go +++ b/gcc/testsuite/go.test/test/bench/garbage/tree.go @@ -68,7 +68,7 @@ const minDepth = 4 func main() { flag.Parse() - t0 := time.Nanoseconds() + t0 := time.Now() maxDepth := *n if minDepth+2 > *n { @@ -93,8 +93,8 @@ func main() { } fmt.Printf("long lived tree of depth %d\t check: %d\n", maxDepth, longLivedTree.itemCheck()) - t1 := time.Nanoseconds() + t1 := time.Now() // Standard gotest benchmark output, collected by build dashboard. - gcstats("BenchmarkTree", *n, t1-t0) + gcstats("BenchmarkTree", *n, t1.Sub(t0)) } diff --git a/gcc/testsuite/go.test/test/bench/garbage/tree2.go b/gcc/testsuite/go.test/test/bench/garbage/tree2.go new file mode 100644 index 00000000000..6d78f72c5b8 --- /dev/null +++ b/gcc/testsuite/go.test/test/bench/garbage/tree2.go @@ -0,0 +1,88 @@ +// Copyright 2012 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package main + +import ( + "flag" + "fmt" + "log" + "os" + "runtime" + "runtime/pprof" + "unsafe" +) + +const BranchingFactor = 4 + +type Object struct { + child [BranchingFactor]*Object +} + +var ( + cpus = flag.Int("cpus", 1, "number of cpus to use") + heapsize = flag.Int64("heapsize", 100*1024*1024, "size of the heap in bytes") + cpuprofile = flag.String("cpuprofile", "", "write cpu profile to file") + + lastPauseNs uint64 = 0 + lastFree uint64 = 0 + heap *Object + calls [20]int + numobjects int64 +) + +func buildHeap() { + objsize := int64(unsafe.Sizeof(Object{})) + heap, _ = buildTree(float64(objsize), float64(*heapsize), 0) + fmt.Printf("*** built heap: %.0f MB; (%d objects * %d bytes)\n", + float64(*heapsize)/1048576, numobjects, objsize) +} + +func buildTree(objsize, size float64, depth int) (*Object, float64) { + calls[depth]++ + x := &Object{} + numobjects++ + subtreeSize := (size - objsize) / BranchingFactor + alloc := objsize + for i := 0; i < BranchingFactor && alloc < size; i++ { + c, n := buildTree(objsize, subtreeSize, depth+1) + x.child[i] = c + alloc += n + } + return x, alloc +} + +func gc() { + runtime.GC() + runtime.UpdateMemStats() + pause := runtime.MemStats.PauseTotalNs + inuse := runtime.MemStats.Alloc + free := runtime.MemStats.TotalAlloc - inuse + fmt.Printf("gc pause: %8.3f ms; collect: %8.0f MB; heapsize: %8.0f MB\n", + float64(pause-lastPauseNs)/1e6, + float64(free-lastFree)/1048576, + float64(inuse)/1048576) + lastPauseNs = pause + lastFree = free +} + +func main() { + flag.Parse() + buildHeap() + runtime.GOMAXPROCS(*cpus) + runtime.UpdateMemStats() + lastPauseNs = runtime.MemStats.PauseTotalNs + lastFree = runtime.MemStats.TotalAlloc - runtime.MemStats.Alloc + if *cpuprofile != "" { + f, err := os.Create(*cpuprofile) + if err != nil { + log.Fatal(err) + } + pprof.StartCPUProfile(f) + defer pprof.StopCPUProfile() + } + for i := 0; i < 10; i++ { + gc() + } +} diff --git a/gcc/testsuite/go.test/test/bench/go1/Makefile b/gcc/testsuite/go.test/test/bench/go1/Makefile new file mode 100644 index 00000000000..94847438f9c --- /dev/null +++ b/gcc/testsuite/go.test/test/bench/go1/Makefile @@ -0,0 +1,7 @@ +include $(GOROOT)/src/Make.inc + +TARG=go1 +GOFILES=\ + dummy.go\ + +include $(GOROOT)/src/Make.pkg diff --git a/gcc/testsuite/go.test/test/bench/go1/_gotest_.6 b/gcc/testsuite/go.test/test/bench/go1/_gotest_.6 new file mode 100644 index 00000000000..9fa1baa99aa --- /dev/null +++ b/gcc/testsuite/go.test/test/bench/go1/_gotest_.6 @@ -0,0 +1,885 @@ +go object linux amd64 weekly.2012-01-15 11312+ X:none + exports automatically generated from + template_test.go in package "go1" + +$$ // exports + package go1 + import log "log" + import ioutil "io/ioutil" + import runtime "runtime" + import bufio "bufio" + import bzip2 "compress/bzip2" + import io "io" + import gzip "compress/gzip" + import testing "testing" + import base64 "encoding/base64" + import strings "strings" + import gob "encoding/gob" + import reflect "reflect" + import template "text/template" + import json "encoding/json" + import bytes "bytes" + type @"".binaryNode struct { @"".item int; @"".left *@"".binaryNode; @"".right *@"".binaryNode } + func (@"".n *@"".binaryNode "noescape") @"".itemCheck() (? int) + func @"".bottomUpTree(@"".item int, @"".depth int) (? *@"".binaryNode) + const @"".minDepth = 4 + func @"".binarytree(@"".n int) + import time "time" // indirect + type @"time".zone struct { @"time".name string; @"time".offset int; @"time".isDST bool } + type @"time".zoneTrans struct { @"time".when int64; @"time".index uint8; @"time".isstd bool; @"time".isutc bool } + type @"time".Location struct { @"time".name string; @"time".zone []@"time".zone; @"time".tx []@"time".zoneTrans; @"time".cacheStart int64; @"time".cacheEnd int64; @"time".cacheZone *@"time".zone } + func (@"time".l *@"time".Location) String() (? string) + func (@"time".l *@"time".Location) @"time".get() (? *@"time".Location) + func (@"time".l *@"time".Location) @"time".lookup(@"time".sec int64) (@"time".name string, @"time".offset int, @"time".isDST bool, @"time".start int64, @"time".end int64) + func (@"time".l *@"time".Location) @"time".lookupName(@"time".name string "noescape") (@"time".offset int, @"time".isDST bool, @"time".ok bool) + func (@"time".l *@"time".Location) @"time".lookupOffset(@"time".offset int) (@"time".name string, @"time".isDST bool, @"time".ok bool) + type @"time".Duration int64 + func (@"time".d @"time".Duration) Hours() (? float64) + func (@"time".d @"time".Duration) Minutes() (? float64) + func (@"time".d @"time".Duration) Nanoseconds() (? int64) { return int64(@"time".d) } + func (@"time".d @"time".Duration) Seconds() (? float64) + func (@"time".d @"time".Duration) String() (? string) + type @"time".Month int + func (@"time".m @"time".Month) String() (? string) { return @"time".months[@"time".m - @"time".Month(1)] } + type @"time".Weekday int + func (@"time".d @"time".Weekday) String() (? string) { return @"time".days[@"time".d] } + type @"time".Time struct { @"time".sec int64; @"time".nsec int32; @"time".loc *@"time".Location } + func (@"time".t @"time".Time) Add(@"time".d @"time".Duration) (? @"time".Time) + func (@"time".t @"time".Time) AddDate(@"time".years int, @"time".months int, @"time".days int) (? @"time".Time) + func (@"time".t @"time".Time "noescape") After(@"time".u @"time".Time "noescape") (? bool) { return @"time".t.@"time".sec > @"time".u.@"time".sec || @"time".t.@"time".sec == @"time".u.@"time".sec && @"time".t.@"time".nsec > @"time".u.@"time".nsec } + func (@"time".t @"time".Time "noescape") Before(@"time".u @"time".Time "noescape") (? bool) { return @"time".t.@"time".sec < @"time".u.@"time".sec || @"time".t.@"time".sec == @"time".u.@"time".sec && @"time".t.@"time".nsec < @"time".u.@"time".nsec } + func (@"time".t @"time".Time) Clock() (@"time".hour int, @"time".min int, @"time".sec int) + func (@"time".t @"time".Time) Date() (@"time".year int, @"time".month @"time".Month, @"time".day int) + func (@"time".t @"time".Time) Day() (? int) + func (@"time".t @"time".Time "noescape") Equal(@"time".u @"time".Time "noescape") (? bool) { return @"time".t.@"time".sec == @"time".u.@"time".sec && @"time".t.@"time".nsec == @"time".u.@"time".nsec } + func (@"time".t @"time".Time) Format(@"time".layout string) (? string) + func (@"time".t *@"time".Time "noescape") GobDecode(@"time".buf []byte "noescape") (? error) + func (@"time".t @"time".Time) GobEncode() (? []byte, ? error) + func (@"time".t @"time".Time) Hour() (? int) + func (@"time".t @"time".Time) ISOWeek() (@"time".year int, @"time".week int) + func (@"time".t @"time".Time) In(@"time".loc *@"time".Location) (? @"time".Time) + func (@"time".t @"time".Time "noescape") IsZero() (? bool) { return @"time".t.@"time".sec == 0 && @"time".t.@"time".nsec == 0 } + func (@"time".t @"time".Time) Local() (? @"time".Time) + func (@"time".t @"time".Time) Location() (? *@"time".Location) + func (@"time".t @"time".Time) MarshalJSON() (? []byte, ? error) + func (@"time".t @"time".Time) Minute() (? int) + func (@"time".t @"time".Time) Month() (? @"time".Month) + func (@"time".t @"time".Time "noescape") Nanosecond() (? int) { return int(@"time".t.@"time".nsec) } + func (@"time".t @"time".Time) Second() (? int) + func (@"time".t @"time".Time) String() (? string) + func (@"time".t @"time".Time "noescape") Sub(@"time".u @"time".Time "noescape") (? @"time".Duration) { return @"time".Duration(@"time".t.@"time".sec - @"time".u.@"time".sec) * @"time".Duration(1000000000) + @"time".Duration(@"time".t.@"time".nsec - @"time".u.@"time".nsec) } + func (@"time".t @"time".Time) UTC() (? @"time".Time) + func (@"time".t @"time".Time "noescape") Unix() (? int64) { return @"time".t.@"time".sec + -62135596800 } + func (@"time".t @"time".Time "noescape") UnixNano() (? int64) { return (@"time".t.@"time".sec + -62135596800) * 1000000000 + int64(@"time".t.@"time".nsec) } + func (@"time".t *@"time".Time "noescape") UnmarshalJSON(@"time".data []byte "noescape") (@"time".err error) + func (@"time".t @"time".Time) Weekday() (? @"time".Weekday) + func (@"time".t @"time".Time) Year() (? int) + func (@"time".t @"time".Time) Zone() (@"time".name string, @"time".offset int) + func (@"time".t @"time".Time) @"time".abs() (? uint64) + func (@"time".t @"time".Time) @"time".date(@"time".full bool) (@"time".year int, @"time".month @"time".Month, @"time".day int, @"time".yday int) + type @"testing".common struct { @"testing".output []byte; @"testing".failed bool; @"testing".start @"time".Time; @"testing".duration @"time".Duration; @"testing".self interface {}; @"testing".signal chan interface {} } + func (@"testing".c *@"testing".common "noescape") Error(@"testing".args ...interface {} "noescape") + func (@"testing".c *@"testing".common "noescape") Errorf(@"testing".format string "noescape", @"testing".args ...interface {} "noescape") + func (@"testing".c *@"testing".common "noescape") Fail() { @"testing".c.@"testing".failed = true } + func (@"testing".c *@"testing".common "noescape") FailNow() + func (@"testing".c *@"testing".common "noescape") Failed() (? bool) { return @"testing".c.@"testing".failed } + func (@"testing".c *@"testing".common "noescape") Fatal(@"testing".args ...interface {} "noescape") + func (@"testing".c *@"testing".common "noescape") Fatalf(@"testing".format string "noescape", @"testing".args ...interface {} "noescape") + func (@"testing".c *@"testing".common "noescape") Log(@"testing".args ...interface {} "noescape") + func (@"testing".c *@"testing".common "noescape") Logf(@"testing".format string "noescape", @"testing".args ...interface {} "noescape") + func (@"testing".c *@"testing".common "noescape") @"testing".log(@"testing".s string) + type @"testing".InternalBenchmark struct { Name string; F func(@"testing".b *@"testing".B) } + type @"testing".BenchmarkResult struct { N int; T @"time".Duration; Bytes int64 } + func (@"testing".r @"testing".BenchmarkResult) NsPerOp() (? int64) + func (@"testing".r @"testing".BenchmarkResult) String() (? string) + func (@"testing".r @"testing".BenchmarkResult) @"testing".mbPerSec() (? float64) + type @"testing".B struct { ? @"testing".common; N int; @"testing".benchmark @"testing".InternalBenchmark; @"testing".bytes int64; @"testing".timerOn bool; @"testing".result @"testing".BenchmarkResult } + func (@"testing".b *@"testing".B "noescape") ResetTimer() + func (@"testing".b *@"testing".B "noescape") SetBytes(@"testing".n int64) { @"testing".b.@"testing".bytes = @"testing".n } + func (@"testing".b *@"testing".B "noescape") StartTimer() + func (@"testing".b *@"testing".B "noescape") StopTimer() + func (@"testing".b *@"testing".B) @"testing".launch() + func (@"testing".b *@"testing".B "noescape") @"testing".nsPerOp() (? int64) + func (@"testing".b *@"testing".B) @"testing".run() (? @"testing".BenchmarkResult) + func (@"testing".b *@"testing".B) @"testing".runN(@"testing".n int) + func (@"testing".b *@"testing".B "noescape") @"testing".trimOutput() + func @"".BenchmarkBinaryTree17(@"".b *@"testing".B "noescape") + func @"".fannkuch(@"".n int) (? int) + func @"".BenchmarkFannkuch11(@"".b *@"testing".B "noescape") + var @"".fasta25m []byte + func @"".fasta(@"".n int) (? []byte) + type @"".fastaBuffer []byte + func (@"".b *@"".fastaBuffer "noescape") Flush() + func (@"".b *@"".fastaBuffer "noescape") NextWrite(@"".n int) (? []byte) + func (@"".b *@"".fastaBuffer "noescape") WriteString(@"".s string "noescape") + const @"".fastaLine = 60 + func @"".fastaRepeat(@"".out *@"".fastaBuffer "noescape", @"".alu []byte "noescape", @"".n int) + const @"".fastaLookupSize = 4096 + const @"".fastaLookupScale float64 = 4095p+0 + var @"".fastaRand uint32 + type @"".fastaAcid struct { @"".sym byte; @"".prob float64; @"".cprob float64; @"".next *@"".fastaAcid } + func @"".fastaComputeLookup(@"".acid []@"".fastaAcid) (? *[4096]*@"".fastaAcid) + func @"".fastaRandom(@"".out *@"".fastaBuffer "noescape", @"".acid []@"".fastaAcid, @"".n int) + var @"".gobbytes []byte + type @"".JSONNode struct { Name string "json:\"name\""; Kids []*@"".JSONNode "json:\"kids\""; CLWeight float64 "json:\"cl_weight\""; Touches int "json:\"touches\""; MinT int64 "json:\"min_t\""; MaxT int64 "json:\"max_t\""; MeanT int64 "json:\"mean_t\"" } + type @"".JSONResponse struct { Tree *@"".JSONNode "json:\"tree\""; Username string "json:\"username\"" } + var @"".gobdata *@"".JSONResponse + func @"".gobinit() + func @"".gobResponse(@"".r *@"".JSONResponse) (? *@"".JSONResponse) + func @"".gobNode(@"".n *@"".JSONNode "noescape") (? *@"".JSONNode) + func @"".gobdec() + func @"".gobenc() + func @"".BenchmarkGobDecode(@"".b *@"testing".B "noescape") + func @"".BenchmarkGobEncode(@"".b *@"testing".B "noescape") + var @"".jsongunz []byte + var @"".jsongz []byte + func @"".init·1() + func @"".gzip() + func @"".gunzip() + func @"".BenchmarkGzip(@"".b *@"testing".B "noescape") + func @"".BenchmarkGunzip(@"".b *@"testing".B "noescape") + var @"".jsonbytes []byte + var @"".jsondata @"".JSONResponse + func @"".init·2() + func @"".jsondec() + func @"".jsonenc() + func @"".BenchmarkJSONEncode(@"".b *@"testing".B "noescape") + func @"".BenchmarkJSONDecode(@"".b *@"testing".B "noescape") + var @"".jsonbz2_base64 string + var @"".revCompTable [256]uint8 + func @"".revcomp(@"".data []byte) + func @"".BenchmarkRevcomp25M(@"".b *@"testing".B "noescape") + const @"".tmplText = "\n{\n\t\"tree\":{{template \"node\" .Tree}},\n\t\"username\":\"{{.Username}}\"\n}\n{{define \"node\"}}\n{\n\t\"name\":\"{{.Name}}\",\n\t\"kids\":[\n\t{{range $i, $k := .Kids}}\n\t\t{{if $i}}\n\t\t\t,\n\t\t{{end}}\n\t\t{{template \"node\" $k}}\n\t{{end}}\n\t],\n\t\"cl_weight\":{{.CLWeight}},\n\t\"touches\":{{.Touches}},\n\t\"min_t\":{{.MinT}},\n\t\"max_t\":{{.MaxT}},\n\t\"mean_t\":{{.MeanT}}\n}\n{{end}}\n" + func @"".stripTabNL(@"".r rune) (? rune) + import parse "text/template/parse" // indirect + type @"text/template/parse".NodeType int + func (@"text/template/parse".t @"text/template/parse".NodeType) Type() (? @"text/template/parse".NodeType) { return @"text/template/parse".t } + type @"text/template/parse".Node interface { Type() (? @"text/template/parse".NodeType); String() (? string) } + type @"text/template/parse".ListNode struct { ? @"text/template/parse".NodeType; Nodes []@"text/template/parse".Node } + func (@"text/template/parse".l *@"text/template/parse".ListNode "noescape") String() (? string) + func (@"text/template/parse".l *@"text/template/parse".ListNode "noescape") @"text/template/parse".append(@"text/template/parse".n @"text/template/parse".Node) { @"text/template/parse".l.Nodes = append(@"text/template/parse".l.Nodes, @"text/template/parse".n) } + type @"text/template/parse".stateFn func(? *@"text/template/parse".lexer) (? @"text/template/parse".stateFn) + type @"text/template/parse".itemType int + func (@"text/template/parse".i @"text/template/parse".itemType) String() (? string) + type @"text/template/parse".item struct { @"text/template/parse".typ @"text/template/parse".itemType; @"text/template/parse".val string } + func (@"text/template/parse".i @"text/template/parse".item) String() (? string) + type @"text/template/parse".lexer struct { @"text/template/parse".name string; @"text/template/parse".input string; @"text/template/parse".leftDelim string; @"text/template/parse".rightDelim string; @"text/template/parse".state @"text/template/parse".stateFn; @"text/template/parse".pos int; @"text/template/parse".start int; @"text/template/parse".width int; @"text/template/parse".items chan @"text/template/parse".item } + func (@"text/template/parse".l *@"text/template/parse".lexer "noescape") @"text/template/parse".accept(@"text/template/parse".valid string "noescape") (? bool) + func (@"text/template/parse".l *@"text/template/parse".lexer "noescape") @"text/template/parse".acceptRun(@"text/template/parse".valid string "noescape") + func (@"text/template/parse".l *@"text/template/parse".lexer "noescape") @"text/template/parse".backup() + func (@"text/template/parse".l *@"text/template/parse".lexer "noescape") @"text/template/parse".emit(@"text/template/parse".t @"text/template/parse".itemType) + func (@"text/template/parse".l *@"text/template/parse".lexer "noescape") @"text/template/parse".errorf(@"text/template/parse".format string "noescape", @"text/template/parse".args ...interface {} "noescape") (? @"text/template/parse".stateFn) + func (@"text/template/parse".l *@"text/template/parse".lexer "noescape") @"text/template/parse".ignore() { @"text/template/parse".l.@"text/template/parse".start = @"text/template/parse".l.@"text/template/parse".pos } + func (@"text/template/parse".l *@"text/template/parse".lexer "noescape") @"text/template/parse".lineNumber() (? int) + func (@"text/template/parse".l *@"text/template/parse".lexer "noescape") @"text/template/parse".next() (@"text/template/parse".r rune) + func (@"text/template/parse".l *@"text/template/parse".lexer) @"text/template/parse".nextItem() (? @"text/template/parse".item) + func (@"text/template/parse".l *@"text/template/parse".lexer "noescape") @"text/template/parse".peek() (? rune) + func (@"text/template/parse".l *@"text/template/parse".lexer "noescape") @"text/template/parse".scanNumber() (? bool) + type @"text/template/parse".CommandNode struct { ? @"text/template/parse".NodeType; Args []@"text/template/parse".Node } + func (@"text/template/parse".c *@"text/template/parse".CommandNode "noescape") String() (? string) + func (@"text/template/parse".c *@"text/template/parse".CommandNode "noescape") @"text/template/parse".append(@"text/template/parse".arg @"text/template/parse".Node) { @"text/template/parse".c.Args = append(@"text/template/parse".c.Args, @"text/template/parse".arg) } + type @"text/template/parse".VariableNode struct { ? @"text/template/parse".NodeType; Ident []string } + func (@"text/template/parse".v *@"text/template/parse".VariableNode "noescape") String() (? string) + type @"text/template/parse".PipeNode struct { ? @"text/template/parse".NodeType; Line int; Decl []*@"text/template/parse".VariableNode; Cmds []*@"text/template/parse".CommandNode } + func (@"text/template/parse".p *@"text/template/parse".PipeNode "noescape") String() (? string) + func (@"text/template/parse".p *@"text/template/parse".PipeNode "noescape") @"text/template/parse".append(@"text/template/parse".command *@"text/template/parse".CommandNode) { @"text/template/parse".p.Cmds = append(@"text/template/parse".p.Cmds, @"text/template/parse".command) } + type @"text/template/parse".Tree struct { Name string; Root *@"text/template/parse".ListNode; @"text/template/parse".funcs []map[string]interface {}; @"text/template/parse".lex *@"text/template/parse".lexer; @"text/template/parse".token [2]@"text/template/parse".item; @"text/template/parse".peekCount int; @"text/template/parse".vars []string } + func (@"text/template/parse".t *@"text/template/parse".Tree) Parse(@"text/template/parse".s string, @"text/template/parse".leftDelim string, @"text/template/parse".rightDelim string, @"text/template/parse".treeSet map[string]*@"text/template/parse".Tree "noescape", @"text/template/parse".funcs ...map[string]interface {}) (@"text/template/parse".tree *@"text/template/parse".Tree, @"text/template/parse".err error) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".action() (@"text/template/parse".n @"text/template/parse".Node) + func (@"text/template/parse".t *@"text/template/parse".Tree) @"text/template/parse".add(@"text/template/parse".treeSet map[string]*@"text/template/parse".Tree "noescape") + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".atEOF() (? bool) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".backup() + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".backup2(@"text/template/parse".t1 @"text/template/parse".item) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".command() (? *@"text/template/parse".CommandNode) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".elseControl() (? @"text/template/parse".Node) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".endControl() (? @"text/template/parse".Node) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".error(@"text/template/parse".err error) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".errorf(@"text/template/parse".format string, @"text/template/parse".args ...interface {} "noescape") + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".expect(@"text/template/parse".expected @"text/template/parse".itemType, @"text/template/parse".context string) (? @"text/template/parse".item) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".expectOneOf(@"text/template/parse".expected1 @"text/template/parse".itemType, @"text/template/parse".expected2 @"text/template/parse".itemType, @"text/template/parse".context string) (? @"text/template/parse".item) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".hasFunction(@"text/template/parse".name string "noescape") (? bool) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".ifControl() (? @"text/template/parse".Node) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".itemList() (@"text/template/parse".list *@"text/template/parse".ListNode, @"text/template/parse".next @"text/template/parse".Node) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".next() (? @"text/template/parse".item) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".parse(@"text/template/parse".treeSet map[string]*@"text/template/parse".Tree "noescape") (@"text/template/parse".next @"text/template/parse".Node) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".parseControl(@"text/template/parse".context string) (@"text/template/parse".lineNum int, @"text/template/parse".pipe *@"text/template/parse".PipeNode, @"text/template/parse".list *@"text/template/parse".ListNode, @"text/template/parse".elseList *@"text/template/parse".ListNode) + func (@"text/template/parse".t *@"text/template/parse".Tree) @"text/template/parse".parseDefinition(@"text/template/parse".treeSet map[string]*@"text/template/parse".Tree "noescape") + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".peek() (? @"text/template/parse".item) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".pipeline(@"text/template/parse".context string) (@"text/template/parse".pipe *@"text/template/parse".PipeNode) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".popVars(@"text/template/parse".n int) { @"text/template/parse".t.@"text/template/parse".vars = @"text/template/parse".t.@"text/template/parse".vars[:@"text/template/parse".n] } + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".rangeControl() (? @"text/template/parse".Node) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".recover(@"text/template/parse".errp *error "noescape") + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".startParse(@"text/template/parse".funcs []map[string]interface {}, @"text/template/parse".lex *@"text/template/parse".lexer) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".stopParse() + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".templateControl() (? @"text/template/parse".Node) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".textOrAction() (? @"text/template/parse".Node) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".unexpected(@"text/template/parse".token @"text/template/parse".item, @"text/template/parse".context string) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".useVar(@"text/template/parse".name string "noescape") (? @"text/template/parse".Node) + func (@"text/template/parse".t *@"text/template/parse".Tree "noescape") @"text/template/parse".withControl() (? @"text/template/parse".Node) + type @"text/template".FuncMap map[string]interface {} + type @"runtime".Type interface {} + type @"reflect".method struct { @"reflect".name *string; @"reflect".pkgPath *string; @"reflect".mtyp *@"runtime".Type; @"reflect".typ *@"runtime".Type; @"reflect".ifn @"unsafe".Pointer; @"reflect".tfn @"unsafe".Pointer } + type @"reflect".ChanDir int + func (@"reflect".d @"reflect".ChanDir) String() (? string) + type @"reflect".StructTag string + func (@"reflect".tag @"reflect".StructTag "noescape") Get(@"reflect".key string "noescape") (? string) + type @"reflect".StructField struct { PkgPath string; Name string; Type @"reflect".Type; Tag @"reflect".StructTag; Offset uintptr; Index []int; Anonymous bool } + type @"reflect".Kind uint + func (@"reflect".k @"reflect".Kind) String() (? string) + type @"reflect".Type interface { Align() (? int); FieldAlign() (? int); Method(? int) (? @"reflect".Method); MethodByName(? string) (? @"reflect".Method, ? bool); NumMethod() (? int); Name() (? string); PkgPath() (? string); Size() (? uintptr); String() (? string); Kind() (? @"reflect".Kind); Implements(@"reflect".u @"reflect".Type) (? bool); AssignableTo(@"reflect".u @"reflect".Type) (? bool); Bits() (? int); ChanDir() (? @"reflect".ChanDir); IsVariadic() (? bool); Elem() (? @"reflect".Type); Field(@"reflect".i int) (? @"reflect".StructField); FieldByIndex(@"reflect".index []int) (? @"reflect".StructField); FieldByName(@"reflect".name string) (? @"reflect".StructField, ? bool); FieldByNameFunc(@"reflect".match func(? string) (? bool)) (? @"reflect".StructField, ? bool); In(@"reflect".i int) (? @"reflect".Type); Key() (? @"reflect".Type); Len() (? int); NumField() (? int); NumIn() (? int); NumOut() (? int); Out(@"reflect".i int) (? @"reflect".Type); @"reflect".runtimeType() (? *@"runtime".Type); @"reflect".common() (? *@"reflect".commonType); @"reflect".uncommon() (? *@"reflect".uncommonType) } + type @"reflect".Method struct { PkgPath string; Name string; Type @"reflect".Type; Func @"reflect".Value; Index int } + type @"reflect".uncommonType struct { @"reflect".name *string; @"reflect".pkgPath *string; @"reflect".methods []@"reflect".method } + func (@"reflect".t *@"reflect".uncommonType "noescape") Method(@"reflect".i int) (@"reflect".m @"reflect".Method) + func (@"reflect".t *@"reflect".uncommonType "noescape") MethodByName(@"reflect".name string "noescape") (@"reflect".m @"reflect".Method, @"reflect".ok bool) + func (@"reflect".t *@"reflect".uncommonType "noescape") Name() (? string) + func (@"reflect".t *@"reflect".uncommonType "noescape") NumMethod() (? int) + func (@"reflect".t *@"reflect".uncommonType "noescape") PkgPath() (? string) + func (@"reflect".t *@"reflect".uncommonType) @"reflect".uncommon() (? *@"reflect".uncommonType) { return @"reflect".t } + type @"reflect".commonType struct { @"reflect".size uintptr; @"reflect".hash uint32; _ uint8; @"reflect".align uint8; @"reflect".fieldAlign uint8; @"reflect".kind uint8; @"reflect".alg *uintptr; @"reflect".string *string; ? *@"reflect".uncommonType; @"reflect".ptrToThis *@"runtime".Type } + func (@"reflect".t *@"reflect".commonType "noescape") Align() (? int) { return int(@"reflect".t.@"reflect".align) } + func (@"reflect".t *@"reflect".commonType "noescape") AssignableTo(@"reflect".u @"reflect".Type "noescape") (? bool) + func (@"reflect".t *@"reflect".commonType "noescape") Bits() (? int) + func (@"reflect".t *@"reflect".commonType "noescape") ChanDir() (? @"reflect".ChanDir) + func (@"reflect".t *@"reflect".commonType "noescape") Elem() (? @"reflect".Type) + func (@"reflect".t *@"reflect".commonType "noescape") Field(@"reflect".i int) (? @"reflect".StructField) + func (@"reflect".t *@"reflect".commonType "noescape") FieldAlign() (? int) { return int(@"reflect".t.@"reflect".fieldAlign) } + func (@"reflect".t *@"reflect".commonType) FieldByIndex(@"reflect".index []int "noescape") (? @"reflect".StructField) + func (@"reflect".t *@"reflect".commonType) FieldByName(@"reflect".name string "noescape") (? @"reflect".StructField, ? bool) + func (@"reflect".t *@"reflect".commonType) FieldByNameFunc(@"reflect".match func(? string) (? bool) "noescape") (? @"reflect".StructField, ? bool) + func (@"reflect".t *@"reflect".commonType "noescape") Implements(@"reflect".u @"reflect".Type) (? bool) + func (@"reflect".t *@"reflect".commonType "noescape") In(@"reflect".i int) (? @"reflect".Type) + func (@"reflect".t *@"reflect".commonType "noescape") IsVariadic() (? bool) + func (@"reflect".t *@"reflect".commonType "noescape") Key() (? @"reflect".Type) + func (@"reflect".t *@"reflect".commonType "noescape") Kind() (? @"reflect".Kind) { return @"reflect".Kind(@"reflect".t.@"reflect".kind & 127) } + func (@"reflect".t *@"reflect".commonType "noescape") Len() (? int) + func (@"reflect".t *@"reflect".commonType "noescape") Method(@"reflect".i int) (@"reflect".m @"reflect".Method) + func (@"reflect".t *@"reflect".commonType "noescape") MethodByName(@"reflect".name string "noescape") (@"reflect".m @"reflect".Method, @"reflect".ok bool) + func (@"reflect".t *@"reflect".commonType "noescape") Name() (? string) + func (@"reflect".t *@"reflect".commonType "noescape") NumField() (? int) + func (@"reflect".t *@"reflect".commonType "noescape") NumIn() (? int) + func (@"reflect".t *@"reflect".commonType "noescape") NumMethod() (? int) + func (@"reflect".t *@"reflect".commonType "noescape") NumOut() (? int) + func (@"reflect".t *@"reflect".commonType "noescape") Out(@"reflect".i int) (? @"reflect".Type) + func (@"reflect".t *@"reflect".commonType "noescape") PkgPath() (? string) + func (@"reflect".t *@"reflect".commonType "noescape") Size() (? uintptr) { return @"reflect".t.@"reflect".size } + func (@"reflect".t *@"reflect".commonType "noescape") String() (? string) { return *@"reflect".t.@"reflect".string } + func (@"reflect".t *@"reflect".commonType) @"reflect".common() (? *@"reflect".commonType) { return @"reflect".t } + func (@"reflect".ct *@"reflect".commonType) @"reflect".ptrTo() (? *@"reflect".commonType) + func (@"reflect".t *@"reflect".commonType) @"reflect".runtimeType() (? *@"runtime".Type) + func (@"reflect".t *@"reflect".commonType) @"reflect".toType() (? @"reflect".Type) + type @"reflect".flag uintptr + func (@"reflect".f @"reflect".flag) @"reflect".kind() (? @"reflect".Kind) { return @"reflect".Kind(@"reflect".f >> 4 & @"reflect".flag(31)) } + func (@"reflect".f @"reflect".flag) @"reflect".mustBe(@"reflect".expected @"reflect".Kind) + func (@"reflect".f @"reflect".flag) @"reflect".mustBeAssignable() + func (@"reflect".f @"reflect".flag) @"reflect".mustBeExported() + type @"reflect".iword @"unsafe".Pointer + type @"reflect".Value struct { @"reflect".typ *@"reflect".commonType; @"reflect".val @"unsafe".Pointer; ? @"reflect".flag } + func (@"reflect".v @"reflect".Value) Addr() (? @"reflect".Value) + func (@"reflect".v @"reflect".Value "noescape") Bool() (? bool) + func (@"reflect".v @"reflect".Value "noescape") Bytes() (? []byte) + func (@"reflect".v @"reflect".Value) Call(@"reflect".in []@"reflect".Value "noescape") (? []@"reflect".Value) + func (@"reflect".v @"reflect".Value) CallSlice(@"reflect".in []@"reflect".Value "noescape") (? []@"reflect".Value) + func (@"reflect".v @"reflect".Value "noescape") CanAddr() (? bool) { return @"reflect".v.@"reflect".flag & @"reflect".flag(4) != @"reflect".flag(0) } + func (@"reflect".v @"reflect".Value "noescape") CanInterface() (? bool) + func (@"reflect".v @"reflect".Value "noescape") CanSet() (? bool) { return @"reflect".v.@"reflect".flag & @"reflect".flag(5) == @"reflect".flag(4) } + func (@"reflect".v @"reflect".Value) Cap() (? int) + func (@"reflect".v @"reflect".Value) Close() + func (@"reflect".v @"reflect".Value "noescape") Complex() (? complex128) + func (@"reflect".v @"reflect".Value) Elem() (? @"reflect".Value) + func (@"reflect".v @"reflect".Value) Field(@"reflect".i int) (? @"reflect".Value) + func (@"reflect".v @"reflect".Value) FieldByIndex(@"reflect".index []int "noescape") (? @"reflect".Value) + func (@"reflect".v @"reflect".Value) FieldByName(@"reflect".name string "noescape") (? @"reflect".Value) + func (@"reflect".v @"reflect".Value) FieldByNameFunc(@"reflect".match func(? string) (? bool) "noescape") (? @"reflect".Value) + func (@"reflect".v @"reflect".Value "noescape") Float() (? float64) + func (@"reflect".v @"reflect".Value) Index(@"reflect".i int) (? @"reflect".Value) + func (@"reflect".v @"reflect".Value "noescape") Int() (? int64) + func (@"reflect".v @"reflect".Value) Interface() (? interface {}) + func (@"reflect".v @"reflect".Value "noescape") InterfaceData() (? [2]uintptr) + func (@"reflect".v @"reflect".Value "noescape") IsNil() (? bool) + func (@"reflect".v @"reflect".Value "noescape") IsValid() (? bool) { return @"reflect".v.@"reflect".flag != @"reflect".flag(0) } + func (@"reflect".v @"reflect".Value "noescape") Kind() (? @"reflect".Kind) + func (@"reflect".v @"reflect".Value) Len() (? int) + func (@"reflect".v @"reflect".Value) MapIndex(@"reflect".key @"reflect".Value) (? @"reflect".Value) + func (@"reflect".v @"reflect".Value) MapKeys() (? []@"reflect".Value) + func (@"reflect".v @"reflect".Value) Method(@"reflect".i int) (? @"reflect".Value) + func (@"reflect".v @"reflect".Value) MethodByName(@"reflect".name string "noescape") (? @"reflect".Value) + func (@"reflect".v @"reflect".Value "noescape") NumField() (? int) + func (@"reflect".v @"reflect".Value "noescape") NumMethod() (? int) + func (@"reflect".v @"reflect".Value "noescape") OverflowComplex(@"reflect".x complex128 "noescape") (? bool) + func (@"reflect".v @"reflect".Value "noescape") OverflowFloat(@"reflect".x float64) (? bool) + func (@"reflect".v @"reflect".Value "noescape") OverflowInt(@"reflect".x int64) (? bool) + func (@"reflect".v @"reflect".Value "noescape") OverflowUint(@"reflect".x uint64) (? bool) + func (@"reflect".v @"reflect".Value) Pointer() (? uintptr) + func (@"reflect".v @"reflect".Value) Recv() (@"reflect".x @"reflect".Value, @"reflect".ok bool) + func (@"reflect".v @"reflect".Value) Send(@"reflect".x @"reflect".Value) + func (@"reflect".v @"reflect".Value) Set(@"reflect".x @"reflect".Value) + func (@"reflect".v @"reflect".Value "noescape") SetBool(@"reflect".x bool) + func (@"reflect".v @"reflect".Value "noescape") SetBytes(@"reflect".x []byte) + func (@"reflect".v @"reflect".Value "noescape") SetComplex(@"reflect".x complex128) + func (@"reflect".v @"reflect".Value "noescape") SetFloat(@"reflect".x float64) + func (@"reflect".v @"reflect".Value "noescape") SetInt(@"reflect".x int64) + func (@"reflect".v @"reflect".Value "noescape") SetLen(@"reflect".n int) + func (@"reflect".v @"reflect".Value) SetMapIndex(@"reflect".key @"reflect".Value, @"reflect".val @"reflect".Value) + func (@"reflect".v @"reflect".Value "noescape") SetPointer(@"reflect".x @"unsafe".Pointer) + func (@"reflect".v @"reflect".Value "noescape") SetString(@"reflect".x string) + func (@"reflect".v @"reflect".Value "noescape") SetUint(@"reflect".x uint64) + func (@"reflect".v @"reflect".Value) Slice(@"reflect".beg int, @"reflect".end int) (? @"reflect".Value) + func (@"reflect".v @"reflect".Value "noescape") String() (? string) + func (@"reflect".v @"reflect".Value) TryRecv() (@"reflect".x @"reflect".Value, @"reflect".ok bool) + func (@"reflect".v @"reflect".Value) TrySend(@"reflect".x @"reflect".Value) (? bool) + func (@"reflect".v @"reflect".Value) Type() (? @"reflect".Type) + func (@"reflect".v @"reflect".Value "noescape") Uint() (? uint64) + func (@"reflect".v @"reflect".Value) UnsafeAddr() (? uintptr) + func (@"reflect".v @"reflect".Value) @"reflect".assignTo(@"reflect".context string "noescape", @"reflect".dst *@"reflect".commonType, @"reflect".target *interface {}) (? @"reflect".Value) + func (@"reflect".v @"reflect".Value) @"reflect".call(@"reflect".method string "noescape", @"reflect".in []@"reflect".Value "noescape") (? []@"reflect".Value) + func (@"reflect".v @"reflect".Value) @"reflect".iword() (? @"reflect".iword) + func (@"reflect".v @"reflect".Value) @"reflect".recv(@"reflect".nb bool) (@"reflect".val @"reflect".Value, @"reflect".ok bool) + func (@"reflect".v @"reflect".Value) @"reflect".send(@"reflect".x @"reflect".Value, @"reflect".nb bool) (@"reflect".selected bool) + type @"text/template".common struct { @"text/template".tmpl map[string]*@"text/template".Template; @"text/template".parseFuncs @"text/template".FuncMap; @"text/template".execFuncs map[string]@"reflect".Value } + type @"io".Writer interface { Write(@"io".p []byte) (@"io".n int, @"io".err error) } + type @"text/template".Template struct { @"text/template".name string; ? *@"text/template/parse".Tree; ? *@"text/template".common; @"text/template".leftDelim string; @"text/template".rightDelim string } + func (@"text/template".t *@"text/template".Template) AddParseTree(@"text/template".name string, @"text/template".tree *@"text/template/parse".Tree) (? *@"text/template".Template, ? error) + func (@"text/template".t *@"text/template".Template) Clone() (? *@"text/template".Template) + func (@"text/template".t *@"text/template".Template) Delims(@"text/template".left string, @"text/template".right string) (? *@"text/template".Template) + func (@"text/template".t *@"text/template".Template) Execute(@"text/template".wr @"io".Writer, @"text/template".data interface {}) (@"text/template".err error) + func (@"text/template".t *@"text/template".Template "noescape") ExecuteTemplate(@"text/template".wr @"io".Writer, @"text/template".name string, @"text/template".data interface {}) (? error) + func (@"text/template".t *@"text/template".Template) Funcs(@"text/template".funcMap @"text/template".FuncMap "noescape") (? *@"text/template".Template) + func (@"text/template".t *@"text/template".Template "noescape") Lookup(@"text/template".name string "noescape") (? *@"text/template".Template) + func (@"text/template".t *@"text/template".Template "noescape") Name() (? string) { return @"text/template".t.@"text/template".name } + func (@"text/template".t *@"text/template".Template) New(@"text/template".name string) (? *@"text/template".Template) + func (@"text/template".t *@"text/template".Template) Parse(@"text/template".text string) (? *@"text/template".Template, ? error) + func (@"text/template".t *@"text/template".Template) ParseFiles(@"text/template".filenames ...string "noescape") (? *@"text/template".Template, ? error) + func (@"text/template".t *@"text/template".Template) ParseGlob(@"text/template".pattern string) (? *@"text/template".Template, ? error) + func (@"text/template".t *@"text/template".Template "noescape") Templates() (? []*@"text/template".Template) + func (@"text/template".t *@"text/template".Template "noescape") @"text/template".associate(@"text/template".new *@"text/template".Template) (? error) + func (@"text/template".t *@"text/template".Template) @"text/template".copy(@"text/template".c *@"text/template".common) (? *@"text/template".Template) + func (@"text/template".t *@"text/template".Template "noescape") @"text/template".init() + var @"".tmpl *@"text/template".Template + func @"".init·3() + func @"".tmplexec() + func @"".BenchmarkTemplate(@"".b *@"testing".B "noescape") + var @"".initdone· uint8 + func @"".init() + var @"time".months [12]string + var @"time".days [7]string + +$$ // local types + +$$ + +! +„ +"".item +tr +t® +runtime.panicindex +q®Z +q®e +q®h +q®h +q®k +q®k +q®m +qr +q®p +qr +qr +qr +qr +q®‚ +q®„ +q®„ +q®† +q®‡ +q®ˆ +"".n +t> +"".n +tr + + + +t®% +tr + +encoding/gob.enc +„ +"".br +sr +sr +s„ +s®f +sr +sr +runtime.elem +„ +„ +®ƒ +„ +®Š +„ +compress/gzip.w +²² +®¼ +"".i +s & +s Y +s & +s Y +type.func(*uint8) *"".JSONResponse +® + +type.error +®u +«v +¢v + +®} +«~ +¢~ + + + +"".jsondata +q®Ú +q®ä +io.init +q1„ + +runtime.strhash +qª + + + + + + + +q( + +q( + +q0 +q +%v +q +%s + +q +q0 +q( +q + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +#qÈ +&q +{ + "tre- + "- +} +{{de- +{ +- + "k- + - + {{if- + - + {{e- + {- + {- + - + "cl_- + - +- + "ma- +- +} +{- + +'q` +q +type.func(*"".binaryNode) int +qq +qq +x- +q +qîƵ4u- +qu- +q +q +q +qq +qq +q( +qq +qu- +qq +x- +q +q +qq +x- +q +q +qq +qq + +qx +q + +q +qp +x„ +q +q +q +q + +q +q0 +q€ +q0 +qx +#q0 +"qx +&q +%qp +)q +(qp +.q +,qH +1q +0qx +q0 +qˆ + q +weak.type.**"".fastaBuffer +x„ +q( +qp +q +qH +q0 +q€ +q0 +qx +q +q +qh +!q +#q +"qx +&q +(q +'qp ++q +,q +/q +q +q +q +q +q +q +type.*runtime.SliceType +x- +q + qH +q +qX +q +qX +q0 +qˆ +q +qH +!q0 + qx +$q +#qH +'q0 +&qx +*q8 +)q€ +/q@ +.q€ +q0 +1qp +q +qP +q0 +type.string +x- +q€ +
q +qp +q8 +x6 +qx +q( +x- +q€ +q8 +q€ +q8 +qˆ +q0 +qˆ +$q +"qH +)q( +'qX +-q( ++qH +0q8 +/qx +q0 +qx +q +qH +type.*runtime.StructType +x- +q +q +q +q +q +q +q +q +q +q +q +q +q +q +q +q +!q +#q +x- +)q ++q +,q +-q +.q +/q +1q +q8 +qx +q( +type.*bytes.Buffer +x6 +qx +q@ +x„ +qˆ +q0 +qx +q@ +q€ +q( +qx +q0 +qx +q@ +x„ +qˆ +$q0 +"qx +(q8 +'q€ +,q8 ++q€ +1q +/qH +q0 +qx +q0 +type.[]uint8 +x- +q€ +q0 +x- +q€ +q0 +qx +q( +qx +q +qH +q@ +q€ + q8 +q€ +'q8 +%q€ +,q@ ++qˆ +/q8 +.qˆ +q0 +qx +q@ +qˆ +go.string."func(*uint8) *base64.decoder" +x- +qq +x- +q +q func(*ui- +q nt8) *ba- +q se64.dec- +q oder +qu6 + +q0 +qx +q@ +
qˆ +q( +qx +q0 +q€ +q0 +q€ +q +qp +q0 +qx + +$q +"qX +)q +'qx +-q( +,q€ +1q +0qp +q( +q€ +q0 +type.string +x„ +qx +q8 +x- +x6 +q€ +q@ +q€ +q8 +q€ +q +qH + q8 +q€ +#q0 +"q€ +'qH +&qˆ +,q( +x- +x- +*q€ +/q +.q +1q +0q +q +q +q +q +q +q +q +q +go.string."compress/gzip" +x- +qq +x- +q
+q compress- +q /gzip +qu6 + +q + q +q +q +q +
q +q +q +q +q +q +q +q +q +q +q +q +q diff --git a/gcc/testsuite/go.test/test/bench/go1/_testmain.6 b/gcc/testsuite/go.test/test/bench/go1/_testmain.6 new file mode 100644 index 00000000000..2920de0f03f --- /dev/null +++ b/gcc/testsuite/go.test/test/bench/go1/_testmain.6 @@ -0,0 +1,261 @@ +go object linux amd64 weekly.2012-01-15 11312+ X:none + exports automatically generated from + _testmain.go in package "main" + +$$ // exports + package main + import runtime "runtime" + import go1 "go1" + import testing "testing" + import regexp "regexp" + import time "time" // indirect + type @"time".zone struct { @"time".name string; @"time".offset int; @"time".isDST bool } + type @"time".zoneTrans struct { @"time".when int64; @"time".index uint8; @"time".isstd bool; @"time".isutc bool } + type @"time".Location struct { @"time".name string; @"time".zone []@"time".zone; @"time".tx []@"time".zoneTrans; @"time".cacheStart int64; @"time".cacheEnd int64; @"time".cacheZone *@"time".zone } + func (@"time".l *@"time".Location) String() (? string) + func (@"time".l *@"time".Location) @"time".get() (? *@"time".Location) + func (@"time".l *@"time".Location) @"time".lookup(@"time".sec int64) (@"time".name string, @"time".offset int, @"time".isDST bool, @"time".start int64, @"time".end int64) + func (@"time".l *@"time".Location) @"time".lookupName(@"time".name string "noescape") (@"time".offset int, @"time".isDST bool, @"time".ok bool) + func (@"time".l *@"time".Location) @"time".lookupOffset(@"time".offset int) (@"time".name string, @"time".isDST bool, @"time".ok bool) + type @"time".Duration int64 + func (@"time".d @"time".Duration) Hours() (? float64) + func (@"time".d @"time".Duration) Minutes() (? float64) + func (@"time".d @"time".Duration) Nanoseconds() (? int64) { return int64(@"time".d) } + func (@"time".d @"time".Duration) Seconds() (? float64) + func (@"time".d @"time".Duration) String() (? string) + type @"time".Month int + func (@"time".m @"time".Month) String() (? string) { return @"time".months[@"time".m - @"time".Month(1)] } + type @"time".Weekday int + func (@"time".d @"time".Weekday) String() (? string) { return @"time".days[@"time".d] } + type @"time".Time struct { @"time".sec int64; @"time".nsec int32; @"time".loc *@"time".Location } + func (@"time".t @"time".Time) Add(@"time".d @"time".Duration) (? @"time".Time) + func (@"time".t @"time".Time) AddDate(@"time".years int, @"time".months int, @"time".days int) (? @"time".Time) + func (@"time".t @"time".Time "noescape") After(@"time".u @"time".Time "noescape") (? bool) { return @"time".t.@"time".sec > @"time".u.@"time".sec || @"time".t.@"time".sec == @"time".u.@"time".sec && @"time".t.@"time".nsec > @"time".u.@"time".nsec } + func (@"time".t @"time".Time "noescape") Before(@"time".u @"time".Time "noescape") (? bool) { return @"time".t.@"time".sec < @"time".u.@"time".sec || @"time".t.@"time".sec == @"time".u.@"time".sec && @"time".t.@"time".nsec < @"time".u.@"time".nsec } + func (@"time".t @"time".Time) Clock() (@"time".hour int, @"time".min int, @"time".sec int) + func (@"time".t @"time".Time) Date() (@"time".year int, @"time".month @"time".Month, @"time".day int) + func (@"time".t @"time".Time) Day() (? int) + func (@"time".t @"time".Time "noescape") Equal(@"time".u @"time".Time "noescape") (? bool) { return @"time".t.@"time".sec == @"time".u.@"time".sec && @"time".t.@"time".nsec == @"time".u.@"time".nsec } + func (@"time".t @"time".Time) Format(@"time".layout string) (? string) + func (@"time".t *@"time".Time "noescape") GobDecode(@"time".buf []byte "noescape") (? error) + func (@"time".t @"time".Time) GobEncode() (? []byte, ? error) + func (@"time".t @"time".Time) Hour() (? int) + func (@"time".t @"time".Time) ISOWeek() (@"time".year int, @"time".week int) + func (@"time".t @"time".Time) In(@"time".loc *@"time".Location) (? @"time".Time) + func (@"time".t @"time".Time "noescape") IsZero() (? bool) { return @"time".t.@"time".sec == 0 && @"time".t.@"time".nsec == 0 } + func (@"time".t @"time".Time) Local() (? @"time".Time) + func (@"time".t @"time".Time) Location() (? *@"time".Location) + func (@"time".t @"time".Time) MarshalJSON() (? []byte, ? error) + func (@"time".t @"time".Time) Minute() (? int) + func (@"time".t @"time".Time) Month() (? @"time".Month) + func (@"time".t @"time".Time "noescape") Nanosecond() (? int) { return int(@"time".t.@"time".nsec) } + func (@"time".t @"time".Time) Second() (? int) + func (@"time".t @"time".Time) String() (? string) + func (@"time".t @"time".Time "noescape") Sub(@"time".u @"time".Time "noescape") (? @"time".Duration) { return @"time".Duration(@"time".t.@"time".sec - @"time".u.@"time".sec) * @"time".Duration(1000000000) + @"time".Duration(@"time".t.@"time".nsec - @"time".u.@"time".nsec) } + func (@"time".t @"time".Time) UTC() (? @"time".Time) + func (@"time".t @"time".Time "noescape") Unix() (? int64) { return @"time".t.@"time".sec + -62135596800 } + func (@"time".t @"time".Time "noescape") UnixNano() (? int64) { return (@"time".t.@"time".sec + -62135596800) * 1000000000 + int64(@"time".t.@"time".nsec) } + func (@"time".t *@"time".Time "noescape") UnmarshalJSON(@"time".data []byte "noescape") (@"time".err error) + func (@"time".t @"time".Time) Weekday() (? @"time".Weekday) + func (@"time".t @"time".Time) Year() (? int) + func (@"time".t @"time".Time) Zone() (@"time".name string, @"time".offset int) + func (@"time".t @"time".Time) @"time".abs() (? uint64) + func (@"time".t @"time".Time) @"time".date(@"time".full bool) (@"time".year int, @"time".month @"time".Month, @"time".day int, @"time".yday int) + type @"testing".common struct { @"testing".output []byte; @"testing".failed bool; @"testing".start @"time".Time; @"testing".duration @"time".Duration; @"testing".self interface {}; @"testing".signal chan interface {} } + func (@"testing".c *@"testing".common "noescape") Error(@"testing".args ...interface {} "noescape") + func (@"testing".c *@"testing".common "noescape") Errorf(@"testing".format string "noescape", @"testing".args ...interface {} "noescape") + func (@"testing".c *@"testing".common "noescape") Fail() { @"testing".c.@"testing".failed = true } + func (@"testing".c *@"testing".common "noescape") FailNow() + func (@"testing".c *@"testing".common "noescape") Failed() (? bool) { return @"testing".c.@"testing".failed } + func (@"testing".c *@"testing".common "noescape") Fatal(@"testing".args ...interface {} "noescape") + func (@"testing".c *@"testing".common "noescape") Fatalf(@"testing".format string "noescape", @"testing".args ...interface {} "noescape") + func (@"testing".c *@"testing".common "noescape") Log(@"testing".args ...interface {} "noescape") + func (@"testing".c *@"testing".common "noescape") Logf(@"testing".format string "noescape", @"testing".args ...interface {} "noescape") + func (@"testing".c *@"testing".common "noescape") @"testing".log(@"testing".s string) + type @"testing".T struct { ? @"testing".common; @"testing".name string; @"testing".startParallel chan bool } + func (@"testing".t *@"testing".T "noescape") Parallel() + func (@"testing".t *@"testing".T "noescape") @"testing".report() + type @"testing".InternalTest struct { Name string; F func(? *@"testing".T) } + var @"".tests []@"testing".InternalTest + type @"testing".BenchmarkResult struct { N int; T @"time".Duration; Bytes int64 } + func (@"testing".r @"testing".BenchmarkResult) NsPerOp() (? int64) + func (@"testing".r @"testing".BenchmarkResult) String() (? string) + func (@"testing".r @"testing".BenchmarkResult) @"testing".mbPerSec() (? float64) + type @"testing".B struct { ? @"testing".common; N int; @"testing".benchmark @"testing".InternalBenchmark; @"testing".bytes int64; @"testing".timerOn bool; @"testing".result @"testing".BenchmarkResult } + func (@"testing".b *@"testing".B "noescape") ResetTimer() + func (@"testing".b *@"testing".B "noescape") SetBytes(@"testing".n int64) { @"testing".b.@"testing".bytes = @"testing".n } + func (@"testing".b *@"testing".B "noescape") StartTimer() + func (@"testing".b *@"testing".B "noescape") StopTimer() + func (@"testing".b *@"testing".B) @"testing".launch() + func (@"testing".b *@"testing".B "noescape") @"testing".nsPerOp() (? int64) + func (@"testing".b *@"testing".B) @"testing".run() (? @"testing".BenchmarkResult) + func (@"testing".b *@"testing".B) @"testing".runN(@"testing".n int) + func (@"testing".b *@"testing".B "noescape") @"testing".trimOutput() + type @"testing".InternalBenchmark struct { Name string; F func(@"testing".b *@"testing".B) } + var @"".benchmarks []@"testing".InternalBenchmark + type @"testing".InternalExample struct { Name string; F func(); Output string } + var @"".examples []@"testing".InternalExample + var @"".matchPat string + import syntax "regexp/syntax" // indirect + type @"regexp/syntax".InstOp uint8 + type @"regexp/syntax".Inst struct { Op @"regexp/syntax".InstOp; Out uint32; Arg uint32; Rune []rune } + func (@"regexp/syntax".i *@"regexp/syntax".Inst "noescape") MatchEmptyWidth(@"regexp/syntax".before rune, @"regexp/syntax".after rune) (? bool) + func (@"regexp/syntax".i *@"regexp/syntax".Inst "noescape") MatchRune(@"regexp/syntax".r rune) (? bool) + func (@"regexp/syntax".i *@"regexp/syntax".Inst "noescape") String() (? string) + func (@"regexp/syntax".i *@"regexp/syntax".Inst "noescape") @"regexp/syntax".op() (? @"regexp/syntax".InstOp) + type @"regexp/syntax".EmptyOp uint8 + type @"regexp/syntax".Prog struct { Inst []@"regexp/syntax".Inst; Start int; NumCap int } + func (@"regexp/syntax".p *@"regexp/syntax".Prog "noescape") Prefix() (@"regexp/syntax".prefix string, @"regexp/syntax".complete bool) + func (@"regexp/syntax".p *@"regexp/syntax".Prog "noescape") StartCond() (? @"regexp/syntax".EmptyOp) + func (@"regexp/syntax".p *@"regexp/syntax".Prog "noescape") String() (? string) + func (@"regexp/syntax".p *@"regexp/syntax".Prog "noescape") @"regexp/syntax".skipNop(@"regexp/syntax".pc uint32) (? *@"regexp/syntax".Inst) + import sync "sync" // indirect + type @"sync".Mutex struct { @"sync".state int32; @"sync".sema uint32 } + func (@"sync".m *@"sync".Mutex) Lock() + func (@"sync".m *@"sync".Mutex) Unlock() + type @"regexp".thread struct { @"regexp".inst *@"regexp/syntax".Inst; @"regexp".cap []int } + type @"regexp".entry struct { @"regexp".pc uint32; @"regexp".t *@"regexp".thread } + type @"regexp".queue struct { @"regexp".sparse []uint32; @"regexp".dense []@"regexp".entry } + type @"regexp".inputBytes struct { @"regexp".str []byte } + func (@"regexp".i *@"regexp".inputBytes "noescape") @"regexp".canCheckPrefix() (? bool) { return true } + func (@"regexp".i *@"regexp".inputBytes "noescape") @"regexp".context(@"regexp".pos int) (? @"regexp/syntax".EmptyOp) + func (@"regexp".i *@"regexp".inputBytes "noescape") @"regexp".hasPrefix(@"regexp".re *@"regexp".Regexp "noescape") (? bool) + func (@"regexp".i *@"regexp".inputBytes "noescape") @"regexp".index(@"regexp".re *@"regexp".Regexp "noescape", @"regexp".pos int) (? int) + func (@"regexp".i *@"regexp".inputBytes "noescape") @"regexp".step(@"regexp".pos int) (? rune, ? int) + type @"regexp".inputString struct { @"regexp".str string } + func (@"regexp".i *@"regexp".inputString "noescape") @"regexp".canCheckPrefix() (? bool) { return true } + func (@"regexp".i *@"regexp".inputString "noescape") @"regexp".context(@"regexp".pos int) (? @"regexp/syntax".EmptyOp) + func (@"regexp".i *@"regexp".inputString "noescape") @"regexp".hasPrefix(@"regexp".re *@"regexp".Regexp "noescape") (? bool) + func (@"regexp".i *@"regexp".inputString "noescape") @"regexp".index(@"regexp".re *@"regexp".Regexp "noescape", @"regexp".pos int) (? int) + func (@"regexp".i *@"regexp".inputString "noescape") @"regexp".step(@"regexp".pos int) (? rune, ? int) + import io "io" // indirect + type @"io".RuneReader interface { ReadRune() (@"io".r rune, @"io".size int, @"io".err error) } + type @"regexp".inputReader struct { @"regexp".r @"io".RuneReader; @"regexp".atEOT bool; @"regexp".pos int } + func (@"regexp".i *@"regexp".inputReader "noescape") @"regexp".canCheckPrefix() (? bool) { return false } + func (@"regexp".i *@"regexp".inputReader "noescape") @"regexp".context(@"regexp".pos int) (? @"regexp/syntax".EmptyOp) { return @"regexp/syntax".EmptyOp(0) } + func (@"regexp".i *@"regexp".inputReader "noescape") @"regexp".hasPrefix(@"regexp".re *@"regexp".Regexp "noescape") (? bool) { return false } + func (@"regexp".i *@"regexp".inputReader "noescape") @"regexp".index(@"regexp".re *@"regexp".Regexp "noescape", @"regexp".pos int) (? int) { return -1 } + func (@"regexp".i *@"regexp".inputReader "noescape") @"regexp".step(@"regexp".pos int) (? rune, ? int) + type @"regexp".input interface { @"regexp".step(@"regexp".pos int) (@"regexp".r rune, @"regexp".width int); @"regexp".canCheckPrefix() (? bool); @"regexp".hasPrefix(@"regexp".re *@"regexp".Regexp) (? bool); @"regexp".index(@"regexp".re *@"regexp".Regexp, @"regexp".pos int) (? int); @"regexp".context(@"regexp".pos int) (? @"regexp/syntax".EmptyOp) } + type @"regexp".machine struct { @"regexp".re *@"regexp".Regexp; @"regexp".p *@"regexp/syntax".Prog; @"regexp".q0 @"regexp".queue; @"regexp".q1 @"regexp".queue; @"regexp".pool []*@"regexp".thread; @"regexp".matched bool; @"regexp".matchcap []int; @"regexp".inputBytes @"regexp".inputBytes; @"regexp".inputString @"regexp".inputString; @"regexp".inputReader @"regexp".inputReader } + func (@"regexp".m *@"regexp".machine "noescape") @"regexp".add(@"regexp".q *@"regexp".queue "noescape", @"regexp".pc uint32, @"regexp".pos int, @"regexp".cap []int "noescape", @"regexp".cond @"regexp/syntax".EmptyOp, @"regexp".t *@"regexp".thread) (? *@"regexp".thread) + func (@"regexp".m *@"regexp".machine "noescape") @"regexp".alloc(@"regexp".i *@"regexp/syntax".Inst) (? *@"regexp".thread) + func (@"regexp".m *@"regexp".machine "noescape") @"regexp".clear(@"regexp".q *@"regexp".queue "noescape") + func (@"regexp".m *@"regexp".machine "noescape") @"regexp".free(@"regexp".t *@"regexp".thread) + func (@"regexp".m *@"regexp".machine "noescape") @"regexp".init(@"regexp".ncap int) + func (@"regexp".m *@"regexp".machine "noescape") @"regexp".match(@"regexp".i @"regexp".input, @"regexp".pos int) (? bool) + func (@"regexp".m *@"regexp".machine) @"regexp".newInputBytes(@"regexp".b []byte) (? @"regexp".input) + func (@"regexp".m *@"regexp".machine) @"regexp".newInputReader(@"regexp".r @"io".RuneReader) (? @"regexp".input) + func (@"regexp".m *@"regexp".machine) @"regexp".newInputString(@"regexp".s string) (? @"regexp".input) + func (@"regexp".m *@"regexp".machine "noescape") @"regexp".step(@"regexp".runq *@"regexp".queue "noescape", @"regexp".nextq *@"regexp".queue "noescape", @"regexp".pos int, @"regexp".nextPos int, @"regexp".c rune, @"regexp".nextCond @"regexp/syntax".EmptyOp) + type @"regexp".Regexp struct { @"regexp".expr string; @"regexp".prog *@"regexp/syntax".Prog; @"regexp".prefix string; @"regexp".prefixBytes []byte; @"regexp".prefixComplete bool; @"regexp".prefixRune rune; @"regexp".cond @"regexp/syntax".EmptyOp; @"regexp".numSubexp int; @"regexp".longest bool; @"regexp".mu @"sync".Mutex; @"regexp".machine []*@"regexp".machine } + func (@"regexp".re *@"regexp".Regexp) Find(@"regexp".b []byte) (? []byte) + func (@"regexp".re *@"regexp".Regexp) FindAll(@"regexp".b []byte, @"regexp".n int) (? [][]byte) + func (@"regexp".re *@"regexp".Regexp) FindAllIndex(@"regexp".b []byte, @"regexp".n int) (? [][]int) + func (@"regexp".re *@"regexp".Regexp) FindAllString(@"regexp".s string, @"regexp".n int) (? []string) + func (@"regexp".re *@"regexp".Regexp) FindAllStringIndex(@"regexp".s string, @"regexp".n int) (? [][]int) + func (@"regexp".re *@"regexp".Regexp) FindAllStringSubmatch(@"regexp".s string, @"regexp".n int) (? [][]string) + func (@"regexp".re *@"regexp".Regexp) FindAllStringSubmatchIndex(@"regexp".s string, @"regexp".n int) (? [][]int) + func (@"regexp".re *@"regexp".Regexp) FindAllSubmatch(@"regexp".b []byte, @"regexp".n int) (? [][][]byte) + func (@"regexp".re *@"regexp".Regexp) FindAllSubmatchIndex(@"regexp".b []byte, @"regexp".n int) (? [][]int) + func (@"regexp".re *@"regexp".Regexp) FindIndex(@"regexp".b []byte) (@"regexp".loc []int) + func (@"regexp".re *@"regexp".Regexp) FindReaderIndex(@"regexp".r @"io".RuneReader) (? []int) + func (@"regexp".re *@"regexp".Regexp) FindReaderSubmatchIndex(@"regexp".r @"io".RuneReader) (? []int) + func (@"regexp".re *@"regexp".Regexp) FindString(@"regexp".s string) (? string) + func (@"regexp".re *@"regexp".Regexp) FindStringIndex(@"regexp".s string) (? []int) + func (@"regexp".re *@"regexp".Regexp) FindStringSubmatch(@"regexp".s string) (? []string) + func (@"regexp".re *@"regexp".Regexp) FindStringSubmatchIndex(@"regexp".s string) (? []int) + func (@"regexp".re *@"regexp".Regexp) FindSubmatch(@"regexp".b []byte) (? [][]byte) + func (@"regexp".re *@"regexp".Regexp) FindSubmatchIndex(@"regexp".b []byte) (? []int) + func (@"regexp".re *@"regexp".Regexp "noescape") LiteralPrefix() (@"regexp".prefix string, @"regexp".complete bool) { return @"regexp".re.@"regexp".prefix, @"regexp".re.@"regexp".prefixComplete } + func (@"regexp".re *@"regexp".Regexp) Match(@"regexp".b []byte) (? bool) + func (@"regexp".re *@"regexp".Regexp) MatchReader(@"regexp".r @"io".RuneReader) (? bool) + func (@"regexp".re *@"regexp".Regexp) MatchString(@"regexp".s string) (? bool) + func (@"regexp".re *@"regexp".Regexp "noescape") NumSubexp() (? int) { return @"regexp".re.@"regexp".numSubexp } + func (@"regexp".re *@"regexp".Regexp) ReplaceAll(@"regexp".src []byte, @"regexp".repl []byte "noescape") (? []byte) + func (@"regexp".re *@"regexp".Regexp) ReplaceAllFunc(@"regexp".src []byte, @"regexp".repl func(? []byte) (? []byte) "noescape") (? []byte) + func (@"regexp".re *@"regexp".Regexp) ReplaceAllString(@"regexp".src string, @"regexp".repl string "noescape") (? string) + func (@"regexp".re *@"regexp".Regexp) ReplaceAllStringFunc(@"regexp".src string, @"regexp".repl func(? string) (? string) "noescape") (? string) + func (@"regexp".re *@"regexp".Regexp "noescape") String() (? string) { return @"regexp".re.@"regexp".expr } + func (@"regexp".re *@"regexp".Regexp) @"regexp".allMatches(@"regexp".s string, @"regexp".b []byte, @"regexp".n int, @"regexp".deliver func(? []int) "noescape") + func (@"regexp".re *@"regexp".Regexp) @"regexp".doExecute(@"regexp".r @"io".RuneReader, @"regexp".b []byte, @"regexp".s string, @"regexp".pos int, @"regexp".ncap int) (? []int) + func (@"regexp".re *@"regexp".Regexp) @"regexp".get() (? *@"regexp".machine) + func (@"regexp".re *@"regexp".Regexp "noescape") @"regexp".pad(@"regexp".a []int) (? []int) + func (@"regexp".re *@"regexp".Regexp) @"regexp".put(@"regexp".z *@"regexp".machine) + var @"".matchRe *@"regexp".Regexp + func @"".matchString(@"".pat string, @"".str string) (@"".result bool, @"".err error) + func @"".main() + var @"".statictmp_0001 [0]@"testing".InternalTest + var @"".statictmp_0002 [10]@"testing".InternalBenchmark + var @"".statictmp_0003 [0]@"testing".InternalExample + var @"".initdone· uint8 + func @"".init() + var @"time".months [12]string + var @"time".days [7]string + +$$ // local types + +$$ + +! +„ +"".matchRe +q® +q« +q„ + + +q( +q( +q( + q( +go.string."go1.BenchmarkGzip" +x- +qq +x- +q +q go1.Benc- +q hmarkGzi- +q p +qu6 + +q +q +q( +
q( +q( +q( +q0 +qˆ +q( +q€ +!q8 + q€ +$q +#qh +(q( +&qH +,q( ++qH +0q( +/qH +qˆ +qˆ +q +qp +go.string."runtime" +x- +qq +x- +q +q runtime +qu6 + +q + q +q +q +q +
q +q +q diff --git a/gcc/testsuite/go.test/test/bench/go1/_testmain.go b/gcc/testsuite/go.test/test/bench/go1/_testmain.go new file mode 100644 index 00000000000..bedc373a575 --- /dev/null +++ b/gcc/testsuite/go.test/test/bench/go1/_testmain.go @@ -0,0 +1,40 @@ +package main + +import target "go1" +import "testing" +import "regexp" + +var tests = []testing.InternalTest{ +} + +var benchmarks = []testing.InternalBenchmark{ + {"go1.BenchmarkBinaryTree17", target.BenchmarkBinaryTree17}, + {"go1.BenchmarkFannkuch11", target.BenchmarkFannkuch11}, + {"go1.BenchmarkGobDecode", target.BenchmarkGobDecode}, + {"go1.BenchmarkGobEncode", target.BenchmarkGobEncode}, + {"go1.BenchmarkGzip", target.BenchmarkGzip}, + {"go1.BenchmarkGunzip", target.BenchmarkGunzip}, + {"go1.BenchmarkJSONEncode", target.BenchmarkJSONEncode}, + {"go1.BenchmarkJSONDecode", target.BenchmarkJSONDecode}, + {"go1.BenchmarkRevcomp25M", target.BenchmarkRevcomp25M}, + {"go1.BenchmarkTemplate", target.BenchmarkTemplate}, +} +var examples = []testing.InternalExample{} + +var matchPat string +var matchRe *regexp.Regexp + +func matchString(pat, str string) (result bool, err error) { + if matchRe == nil || matchPat != pat { + matchPat = pat + matchRe, err = regexp.Compile(matchPat) + if err != nil { + return + } + } + return matchRe.MatchString(str), nil +} + +func main() { + testing.Main(matchString, tests, benchmarks, examples) +} diff --git a/gcc/testsuite/go.test/test/bench/go1/binarytree_test.go b/gcc/testsuite/go.test/test/bench/go1/binarytree_test.go new file mode 100644 index 00000000000..c64c4b88166 --- /dev/null +++ b/gcc/testsuite/go.test/test/bench/go1/binarytree_test.go @@ -0,0 +1,63 @@ +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// This benchmark, taken from the shootout, tests garbage collector +// performance by generating and discarding large binary trees. + +package go1 + +import "testing" + +type binaryNode struct { + item int + left, right *binaryNode +} + +func bottomUpTree(item, depth int) *binaryNode { + if depth <= 0 { + return &binaryNode{item: item} + } + return &binaryNode{item, bottomUpTree(2*item-1, depth-1), bottomUpTree(2*item, depth-1)} +} + +func (n *binaryNode) itemCheck() int { + if n.left == nil { + return n.item + } + return n.item + n.left.itemCheck() - n.right.itemCheck() +} + +const minDepth = 4 + +func binarytree(n int) { + maxDepth := n + if minDepth+2 > n { + maxDepth = minDepth + 2 + } + stretchDepth := maxDepth + 1 + + check := bottomUpTree(0, stretchDepth).itemCheck() + //fmt.Printf("stretch tree of depth %d\t check: %d\n", stretchDepth, check) + + longLivedTree := bottomUpTree(0, maxDepth) + + for depth := minDepth; depth <= maxDepth; depth += 2 { + iterations := 1 << uint(maxDepth-depth+minDepth) + check = 0 + + for i := 1; i <= iterations; i++ { + check += bottomUpTree(i, depth).itemCheck() + check += bottomUpTree(-i, depth).itemCheck() + } + //fmt.Printf("%d\t trees of depth %d\t check: %d\n", iterations*2, depth, check) + } + longLivedTree.itemCheck() + //fmt.Printf("long lived tree of depth %d\t check: %d\n", maxDepth, longLivedTree.itemCheck()) +} + +func BenchmarkBinaryTree17(b *testing.B) { + for i := 0; i < b.N; i++ { + binarytree(17) + } +} diff --git a/gcc/testsuite/go.test/test/bench/go1/dummy.go b/gcc/testsuite/go.test/test/bench/go1/dummy.go new file mode 100644 index 00000000000..4956bc7b79f --- /dev/null +++ b/gcc/testsuite/go.test/test/bench/go1/dummy.go @@ -0,0 +1,3 @@ +package go1 + +// Nothing to see here: everything is in the _test files. diff --git a/gcc/testsuite/go.test/test/bench/go1/fannkuch_test.go b/gcc/testsuite/go.test/test/bench/go1/fannkuch_test.go new file mode 100644 index 00000000000..ae45bfd8813 --- /dev/null +++ b/gcc/testsuite/go.test/test/bench/go1/fannkuch_test.go @@ -0,0 +1,84 @@ +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// This benchmark, taken from the shootout, tests array indexing +// and array bounds elimination performance. + +package go1 + +import "testing" + +func fannkuch(n int) int { + if n < 1 { + return 0 + } + + n1 := n - 1 + perm := make([]int, n) + perm1 := make([]int, n) + count := make([]int, n) + + for i := 0; i < n; i++ { + perm1[i] = i // initial (trivial) permutation + } + + r := n + didpr := 0 + flipsMax := 0 + for { + if didpr < 30 { + didpr++ + } + for ; r != 1; r-- { + count[r-1] = r + } + + if perm1[0] != 0 && perm1[n1] != n1 { + flips := 0 + for i := 1; i < n; i++ { // perm = perm1 + perm[i] = perm1[i] + } + k := perm1[0] // cache perm[0] in k + for { // k!=0 ==> k>0 + for i, j := 1, k-1; i < j; i, j = i+1, j-1 { + perm[i], perm[j] = perm[j], perm[i] + } + flips++ + // Now exchange k (caching perm[0]) and perm[k]... with care! + j := perm[k] + perm[k] = k + k = j + if k == 0 { + break + } + } + if flipsMax < flips { + flipsMax = flips + } + } + + for ; r < n; r++ { + // rotate down perm[0..r] by one + perm0 := perm1[0] + for i := 0; i < r; i++ { + perm1[i] = perm1[i+1] + } + perm1[r] = perm0 + count[r]-- + if count[r] > 0 { + break + } + } + if r == n { + return flipsMax + } + } + return 0 +} + +func BenchmarkFannkuch11(b *testing.B) { + for i := 0; i < b.N; i++ { + fannkuch(11) + } +} diff --git a/gcc/testsuite/go.test/test/bench/go1/fasta_test.go b/gcc/testsuite/go.test/test/bench/go1/fasta_test.go new file mode 100644 index 00000000000..dcb2d1055d9 --- /dev/null +++ b/gcc/testsuite/go.test/test/bench/go1/fasta_test.go @@ -0,0 +1,164 @@ +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package go1 + +// Not a benchmark; input for revcomp. + +var fasta25m = fasta(25e6) + +func fasta(n int) []byte { + out := make(fastaBuffer, 0, 11*n) + + iub := []fastaAcid{ + {prob: 0.27, sym: 'a'}, + {prob: 0.12, sym: 'c'}, + {prob: 0.12, sym: 'g'}, + {prob: 0.27, sym: 't'}, + {prob: 0.02, sym: 'B'}, + {prob: 0.02, sym: 'D'}, + {prob: 0.02, sym: 'H'}, + {prob: 0.02, sym: 'K'}, + {prob: 0.02, sym: 'M'}, + {prob: 0.02, sym: 'N'}, + {prob: 0.02, sym: 'R'}, + {prob: 0.02, sym: 'S'}, + {prob: 0.02, sym: 'V'}, + {prob: 0.02, sym: 'W'}, + {prob: 0.02, sym: 'Y'}, + } + + homosapiens := []fastaAcid{ + {prob: 0.3029549426680, sym: 'a'}, + {prob: 0.1979883004921, sym: 'c'}, + {prob: 0.1975473066391, sym: 'g'}, + {prob: 0.3015094502008, sym: 't'}, + } + + alu := []byte( + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA") + + out.WriteString(">ONE Homo sapiens alu\n") + fastaRepeat(&out, alu, 2*n) + out.WriteString(">TWO IUB ambiguity codes\n") + fastaRandom(&out, iub, 3*n) + out.WriteString(">THREE Homo sapiens frequency\n") + fastaRandom(&out, homosapiens, 5*n) + return out +} + +type fastaBuffer []byte + +func (b *fastaBuffer) Flush() { + panic("flush") +} + +func (b *fastaBuffer) WriteString(s string) { + p := b.NextWrite(len(s)) + copy(p, s) +} + +func (b *fastaBuffer) NextWrite(n int) []byte { + p := *b + if len(p)+n > cap(p) { + b.Flush() + p = *b + } + out := p[len(p) : len(p)+n] + *b = p[:len(p)+n] + return out +} + +const fastaLine = 60 + +func fastaRepeat(out *fastaBuffer, alu []byte, n int) { + buf := append(alu, alu...) + off := 0 + for n > 0 { + m := n + if m > fastaLine { + m = fastaLine + } + buf1 := out.NextWrite(m + 1) + copy(buf1, buf[off:]) + buf1[m] = '\n' + if off += m; off >= len(alu) { + off -= len(alu) + } + n -= m + } +} + +const ( + fastaLookupSize = 4096 + fastaLookupScale float64 = fastaLookupSize - 1 +) + +var fastaRand uint32 = 42 + +type fastaAcid struct { + sym byte + prob float64 + cprob float64 + next *fastaAcid +} + +func fastaComputeLookup(acid []fastaAcid) *[fastaLookupSize]*fastaAcid { + var lookup [fastaLookupSize]*fastaAcid + var p float64 + for i := range acid { + p += acid[i].prob + acid[i].cprob = p * fastaLookupScale + if i > 0 { + acid[i-1].next = &acid[i] + } + } + acid[len(acid)-1].cprob = 1.0 * fastaLookupScale + + j := 0 + for i := range lookup { + for acid[j].cprob < float64(i) { + j++ + } + lookup[i] = &acid[j] + } + + return &lookup +} + +func fastaRandom(out *fastaBuffer, acid []fastaAcid, n int) { + const ( + IM = 139968 + IA = 3877 + IC = 29573 + ) + lookup := fastaComputeLookup(acid) + for n > 0 { + m := n + if m > fastaLine { + m = fastaLine + } + buf := out.NextWrite(m + 1) + f := fastaLookupScale / IM + myrand := fastaRand + for i := 0; i < m; i++ { + myrand = (myrand*IA + IC) % IM + r := float64(int(myrand)) * f + a := lookup[int(r)] + for a.cprob < r { + a = a.next + } + buf[i] = a.sym + } + fastaRand = myrand + buf[m] = '\n' + n -= m + } +} diff --git a/gcc/testsuite/go.test/test/bench/go1/gob_test.go b/gcc/testsuite/go.test/test/bench/go1/gob_test.go new file mode 100644 index 00000000000..00eeed57a56 --- /dev/null +++ b/gcc/testsuite/go.test/test/bench/go1/gob_test.go @@ -0,0 +1,95 @@ +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// This benchmark tests gob encoding and decoding performance. + +package go1 + +import ( + "bytes" + "encoding/gob" + "encoding/json" + "io/ioutil" + "log" + "reflect" + "testing" +) + +var ( + gobbytes []byte + gobdata *JSONResponse +) + +func gobinit() { + // gobinit is called after json's init, + // because it uses jsondata. + gobdata = gobResponse(&jsondata) + + var buf bytes.Buffer + if err := gob.NewEncoder(&buf).Encode(gobdata); err != nil { + panic(err) + } + gobbytes = buf.Bytes() + + var r JSONResponse + if err := gob.NewDecoder(bytes.NewBuffer(gobbytes)).Decode(&r); err != nil { + panic(err) + } + if !reflect.DeepEqual(gobdata, &r) { + log.Printf("%v\n%v", jsondata, r) + b, _ := json.Marshal(&jsondata) + br, _ := json.Marshal(&r) + log.Printf("%s\n%s\n", b, br) + panic("gob: encode+decode lost data") + } +} + +// gob turns [] into null, so make a copy of the data structure like that +func gobResponse(r *JSONResponse) *JSONResponse { + return &JSONResponse{gobNode(r.Tree), r.Username} +} + +func gobNode(n *JSONNode) *JSONNode { + n1 := new(JSONNode) + *n1 = *n + if len(n1.Kids) == 0 { + n1.Kids = nil + } else { + for i, k := range n1.Kids { + n1.Kids[i] = gobNode(k) + } + } + return n1 +} + +func gobdec() { + if gobbytes == nil { + panic("gobdata not initialized") + } + var r JSONResponse + if err := gob.NewDecoder(bytes.NewBuffer(gobbytes)).Decode(&r); err != nil { + panic(err) + } + _ = r +} + +func gobenc() { + if err := gob.NewEncoder(ioutil.Discard).Encode(&gobdata); err != nil { + panic(err) + } +} + +func BenchmarkGobDecode(b *testing.B) { + b.SetBytes(int64(len(gobbytes))) + for i := 0; i < b.N; i++ { + gobdec() + } +} + +func BenchmarkGobEncode(b *testing.B) { + b.SetBytes(int64(len(gobbytes))) + for i := 0; i < b.N; i++ { + gobenc() + } +} diff --git a/gcc/testsuite/go.test/test/bench/go1/gzip_test.go b/gcc/testsuite/go.test/test/bench/go1/gzip_test.go new file mode 100644 index 00000000000..c9eeb175f53 --- /dev/null +++ b/gcc/testsuite/go.test/test/bench/go1/gzip_test.go @@ -0,0 +1,69 @@ +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// This benchmark tests gzip and gunzip performance. + +package go1 + +import ( + "bytes" + gz "compress/gzip" + "io" + "io/ioutil" + "testing" +) + +var ( + jsongunz = bytes.Repeat(jsonbytes, 10) + jsongz []byte +) + +func init() { + var buf bytes.Buffer + c, err := gz.NewWriter(&buf) + if err != nil { + panic(err) + } + c.Write(jsongunz) + c.Close() + jsongz = buf.Bytes() +} + +func gzip() { + c, err := gz.NewWriter(ioutil.Discard) + if err != nil { + panic(err) + } + if _, err := c.Write(jsongunz); err != nil { + panic(err) + } + if err := c.Close(); err != nil { + panic(err) + } +} + +func gunzip() { + r, err := gz.NewReader(bytes.NewBuffer(jsongz)) + if err != nil { + panic(err) + } + if _, err := io.Copy(ioutil.Discard, r); err != nil { + panic(err) + } + r.Close() +} + +func BenchmarkGzip(b *testing.B) { + b.SetBytes(int64(len(jsongunz))) + for i := 0; i < b.N; i++ { + gzip() + } +} + +func BenchmarkGunzip(b *testing.B) { + b.SetBytes(int64(len(jsongunz))) + for i := 0; i < b.N; i++ { + gunzip() + } +} diff --git a/gcc/testsuite/go.test/test/bench/go1/json_test.go b/gcc/testsuite/go.test/test/bench/go1/json_test.go new file mode 100644 index 00000000000..5a3012167b1 --- /dev/null +++ b/gcc/testsuite/go.test/test/bench/go1/json_test.go @@ -0,0 +1,84 @@ +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// This benchmark tests JSON encoding and decoding performance. + +package go1 + +import ( + "compress/bzip2" + "encoding/base64" + "encoding/json" + "io" + "io/ioutil" + "strings" + "testing" +) + +var ( + jsonbytes []byte + jsondata JSONResponse +) + +func init() { + var r io.Reader + r = strings.NewReader(jsonbz2_base64) + r = base64.NewDecoder(base64.StdEncoding, r) + r = bzip2.NewReader(r) + b, err := ioutil.ReadAll(r) + if err != nil { + panic(err) + } + jsonbytes = b + + if err := json.Unmarshal(jsonbytes, &jsondata); err != nil { + panic(err) + } + gobinit() +} + +type JSONResponse struct { + Tree *JSONNode `json:"tree"` + Username string `json:"username"` +} + +type JSONNode struct { + Name string `json:"name"` + Kids []*JSONNode `json:"kids"` + CLWeight float64 `json:"cl_weight"` + Touches int `json:"touches"` + MinT int64 `json:"min_t"` + MaxT int64 `json:"max_t"` + MeanT int64 `json:"mean_t"` +} + +func jsondec() { + var r JSONResponse + if err := json.Unmarshal(jsonbytes, &r); err != nil { + panic(err) + } + _ = r +} + +func jsonenc() { + buf, err := json.Marshal(&jsondata) + if err != nil { + panic(err) + } + _ = buf +} + +func BenchmarkJSONEncode(b *testing.B) { + b.SetBytes(int64(len(jsonbytes))) + for i := 0; i < b.N; i++ { + jsonenc() + } +} + +func BenchmarkJSONDecode(b *testing.B) { + b.SetBytes(int64(len(jsonbytes))) + for i := 0; i < b.N; i++ { + jsondec() + } +} diff --git a/gcc/testsuite/go.test/test/bench/go1/jsondata_test.go b/gcc/testsuite/go.test/test/bench/go1/jsondata_test.go new file mode 100644 index 00000000000..7d42c966579 --- /dev/null +++ b/gcc/testsuite/go.test/test/bench/go1/jsondata_test.go @@ -0,0 +1,1818 @@ +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Input for JSON and other benchmarks. +// This was generated by starting with a 2MB JSON file with actual data +// about open source revision history, then compressing with bzip2 -9, +// then encoding to base64 with openssl enc -e -base64. +// The result is 125kB of source instead of 2MB. +// We compile the data into the binary so that the benchmark is +// a stand-alone binary that can be copied easily from machine to +// machine. json_test.go decodes this during init. + +package go1 + +var jsonbz2_base64 = "QlpoOTFBWSZTWZ0H0LkG0bxfgFH8UAf/8D////q////6YSvJveAAAAAH3ddt7gAN" + + "FrKppN9gw0gA++fGB9xKkUpX0YWTENCgqzUW1tlsyMB2w9nnvNSigNyS+3cui5zA" + + "AAAAAAAAAI4kILu6ytuWTLBbaPXfc+A+PQEgNAG1ZMBYWnWwPoFrGjoBnYMumlUF" + + "UKA7NVBQgut30zzu8eM2tsoapJ7u41djLsxZarplSoJouxrdfHrHPSiqAGgkAD6D" + + "QfT0ABu7gG1qDtdVHVXp7vWuBoBk2wEOjKChQ5bvbh3riupXZycASbaiQEECRKib" + + "ZFJFtqWjR7bsGoaa1lIFPRoKVQKoJFyqbWr5OB1Aie2pobm1EJKqVBU1EE2lCg6a" + + "AUBV9hqL00q9btQ0J9hqu2zavWVdjI6aAusU22tNa+8m70GjRqarKRWtUDW2yFBI" + + "1kBrrqrxeX3AyB9AD0wAAAeZ6weqV1rVu8UVICgAAABeDn2cAAd9gAACI+7DvjHo" + + "j73u8X2dDXT2x6adeFOTNe7BvavozFezkV1xXtJzu8H0983QAHr5aPT42iem53fX" + + "23IDr7YejQNtVVZr24gGgB0VQffPXH18g9DoaDW8vt729h9bt72XsKth0ANxgodG" + + "iRxvYclAAAAAnpqRtgGvcbo9ABpy6aPQADRZ3aACjyox4NawKCqNdA6offa1WtPc" + + "fdjQUPvauprcLoPe2oaplp2w7cnOHdlF27xvPY1QU67vc8goBRttLYKaHXkPAAAA" + + "AAdyFFaYCVClAVSlCqVSilFUKEgoNT0CAQCBAk00g1T0jQNNPSbKADQxAJEBESIg" + + "Seomk9EB6mjQ0NNGgAAAAkEgkiGk0CR6U9CNNNNNPQRo0ANAaAAk9UpEQmoNNRqe" + + "U02o00AAADQABoACJEAlKamUCjZT9UGnqAAG1AGgAAAFRJCAQCBA0SYjTKbQmqea" + + "p6YU2o09Q9TT00nAlwPEuSelCeXl28B3IYIQHEwXUMSCvlAYS5LkrZn+XhHHAXZz" + + "FTJHAzrKZzYWC0pthA9SCmbkyVzoHbSUjhnAfBrYpwWYIB7GRjOjDQqokMbJENSO" + + "SBCN0WhaRhQWpVuoOLN0NPRed7eO5eW2lv5L+X/jf7EpJkEUNMJKZREogmkjMgZJ" + + "BiEEEliRIUKAoiaSEoDQZJBhKEZEQySQCAIIFNIMwCiSYRSYzKMkSSlI0xZMZKko" + + "RKlRtkmWJIrNNIBEJEYiJBhGMMkWYxRqUsmjKJMmCFJMaSmiyDSaEJtBIJpANKMN" + + "JEkpGQAYjLNETGUBRAlBKURgsC0wzKZhRmhiYIQZIsZCIIMiiNmFCCiSZNjI0khE" + + "AYSEUkjTMSZskZKRQWJoRNBI2IojZmMhTIkQEgyREEMoomDSiYxAZMECFCSKIkGg" + + "kIDIw2MNAlgyA0SmKWSSyIaRCSDDIkZmNGghgyAEoERokkWTA0xZBEQhmUSBGmaQ" + + "aQBFmRJMokwxIyRSWbAkbCUFlAhgUISJIRkySYhAxoUARCSaIJMkyiZJNBMyGRIh" + + "Y0komKImgMDI/038qLf/av/bWSNVEtmFRx/2aaDVmKkY0NkIRDGJEWoEGLf9g9MV" + + "UJWGSu0pWVpSOdWDVjQJGRSChGBGDGhNNMYYwjEsaFISGPT3TbFXk873Xq8vPa9b" + + "0dcco0UEPXIl/+em0IMHNYJaXBEsiKQh/7QwsC9gAauDvWtMEBWhGBIBAerIYlBU" + + "SzPasze15BfAyGrr284QNjGNEmaUphiMxEMwCZjAYRpMiZBMpEMkkQzIwTDu5zru" + + "Xd1xdQ6A6E7m7d03OLnXOxd3HBu50dl0JOhxS4HdHczuO647uuLu6650O67t3Duu" + + "3DucukzRKIMhsUjSQQxDIzQJgxohEkYTYkZsAxSDGCJJERhpEAygoZRESSEjMpFE" + + "0UpJlBkIYwoyQ7/2f9H/Py8roY3wEn8nr7+72ybZtybdqY06yp1tjGVmsmJvG48y" + + "89EXnvy9F6OvX0vpBSIEiSRAmgSASYSkCGBkyc5J63pgiRBNsJW2xjGmmNsf9v7R" + + "z1rueFmZcfXzw/zTGRYxsYm2NjbbfXD64GtivKx5t9eubzmsMTbf9rTfKRsYx7YR" + + "jHWL7OoAJpsFBJgyAEzSJiLHxfJKWQgSlJjGduRqRxDIoETG4wj+VgUjnMt5PXnm" + + "vEQwO7ojzu7lxu7uasg9T00zjrtcaG2RKIwyHx2vUcbjd0OXXvfNafFE3u3t7bu9" + + "TpJ1t6SKh9vi13hQUX4d307pPHt553zxxHMGb4KrbbvJGTCcNs3WmOyG2fg5vsuZ" + + "jMi+lacpNcvr0XeKDnafDcIvhyL7927rr7/Pzfj7qLVW5dFKIg8+fKpuxf+vfhB+" + + "73vWXz3qCPPfw32Mn4c/9mtONctW/fc1sYad9JYn/D1DlDPoyyc7D5bSi3ncMPNH" + + "bWmvm42eODHImqooiuXwn95XZlmKYKGK7KdA6lrgzZpEiUccypzKofPy4kbjq6Nh" + + "o/ou++j5g2i5alDG/G3Cb0yaOY3lH7wd83fLG1uQ0nDG18UHnnOOsy+Y4u2Nv5Hl" + + "jTCKmSJYyBhnB1Lbbafjgaat8zzctvDjPPy7e5IdyZHPSTxq/zkHjinrI5v0/nmG" + + "Pp+JUz4odkc9b4/cze19oRNOjG2wb+PkWtt4RRjbBsfupHPO3Mmgc18az57U+TM7" + + "gQsH90UPHJCZN4WsaY383qkbxxO20pI23JHbCr3ssnqkVFJG/lN5x6yQydwiaSA6" + + "rcgBoSxEDRKIuS1slJsq1MtS6koA5+jFGb17XFu0owrTZZSqsjrkmLVo2tSN44ac" + + "fvD3aWfOerth5lG/Jlkfp6bqUbOZs2FpVptDIwCuWVgqIgkgJMtDBFi+2FpRDhEI" + + "JAKJtPXloMoKGWpU0YvH9h2nx/hxra8/8UoaoWbia9EeoTlN7Bd5PNdcCDKemn+L" + + "cY2qMUXGibc0a33/wjqMN0s8PmTeeup76JA7aKr1nMbhIkn1aX4m5rTPH4aOBlTQ" + + "I35HXHwtJ9z1XuF9EQDwDnCS3S9W358a/E4pTeTSVvyKGWTK/n4Xp7V4dB64Ua3Q" + + "BIaDtzTsXpXV1k9E54ousxG/XtEhuaGmyCefTL/r3478anc78deNRjg9uchGVxVD" + + "Fq6cMZqIdp0ihq0xoIf1zldyBS011SFzq08qfSxV8u0cT70dZgp8ebjk800pU8m2" + + "s1kKdj+zvmBEEU+P0+FlzrhOf/ifG2tOsmrlp7B88bbCY9u1VFK7YavjSQ7xtE94" + + "3aiJb59/et60wn2vrgeV/jeNd+O/Wt/fp6dNf7iJA5QICcGyiKgpFEFQiCjEGEQC" + + "LBIioACSIqiCxSCqIxJIw1GQ0Ua1Vam2qYsmg1rVTbQlmjVbWbaGLbU1kWtlqWrN" + + "LVNNaaQICZqIhD/QiASyQCUEBKiRKRAJSUiASySKRAJSD/zAgJUghMIgEojKiCf+" + + "CIBP9wICfq+/889/0uxkuba/pJdybzbJvEsZ/CpEx89uGn3OONVtyYDHCGIxNyIx" + + "JsYgJYbH+I5RK73DuMZminldjp3e8QpDJju1QToo7pQFEpABpEV4CLQo2QicBAbo" + + "SEINjsMsDt9BO4nJzGstqAmgEJwhRyggJYoMJE0sJoa0zOdEgXdwiQssy4L3pzbM" + + "CwOaLEYFDBQKzaJCjFh2yhQOHbgLVMHXFUf7jhKTXPWsNDuEPXRHfJuLlKqls5Tx" + + "pCC1IgIHnTm5PeWkwwjobODcCdTCa0YoDvMlcZwvmQTkg8KC06oALrhzZqrQmQq6" + + "E28rdrSUxBeLkBshIKRh04g4LDdsmTCpNKSszbu9lHOoAwkmTDrOKCmSqExdOsOV" + + "D1XsAQpFVMukLCcGYGVFpAp4Bg0VnXFFjjdC8avBE6BepA3q6bOgot8LtHTiIlkb" + + "ARVEcldJoYt4Pimls9rpBzDNzeMwOdNAdSkWo4CrsTZ065yPaODXMCkcZCarR0LU" + + "voX1R3nDEsLtlyklMo3qrYHIguO1Ci7xRXFwJZjfTrtZfAyzUKhgJcLOIzeTvWjG" + + "zDE27OYME6dM3Z2kVeKcV1I4jKga0x3vCKlcUmkjRE1Zzsmxsq7L3zOnQ8wzeGDZ" + + "pQO0uN0NpZhcQSuVETbLL2zvKTzqjtBhwIXGaksi8rYKx2Wi6C1J3Ulb1dwqkjat" + + "FU6mO1F5Ii+bGnOMaOlc5EKekFDaQ9tjCU1yqcE66xRVh1ndLcBt7ThNI8LbowKP" + + "Md0AHRNhdYOJksYIQETYuK3ytX1UEkFHZLCghijoBdFzCgKJmlJSADdF5CnsMoIp" + + "pMjeqUgBrXACCcshXWsqyAgenB7IMoT6ZghKl5ljwkJTUVQuhTp3YIWgQCl8eBO7" + + "FTzwWGBEw8BDaLuSqMmM0wWE6QVsFIpRwmCRA128BCKpdaVunHbkyuScBsqeFjLJ" + + "qAw0WUUIhMN3S5Keua7Wynjnew31G8jecPcVIYxGw3trGziGoCdTHKPOEpO5732V" + + "4lnVA4VvKsc+R4OHHQz2JkHFdwSzeiDBUGBiQAJcznd7Z0oCmMykE5KjZuKCyKhd" + + "5nTSBBtu1sj6s2JCiZBgpYdOIM4luy6evBlYUYldUQQZKOoAiZL4d7fe003l07CD" + + "omKNzZgXiveIrzXjCZel4BcyY752rec3eRoT6jAGZAGEc3kkZQhLcVNCq+qVFSim" + + "BuCKZeQr5FF85WTJZzIXXwto0cB2CpntlWr0xWTfLt1yrDg8503VJAdH0uqes4bJ" + + "d5wsYFakMZlVS7lsEko6gj0LqyENh3rvG7qYJiQ9xoY33UthsUwRtEF6HUjtHWGA" + + "1q5N1HNgiI7rFa5QiEzuCDZ03KzKswfM7185zaRUkRyiUUssQSPAwlc6CAaa2KwB" + + "CwsOVTUrpamy4uS+mkF2pVMrpWpG7eYkYjcqSMY+pyDKhDILMmR5HGGc5ml4LJEa" + + "A2sxQOlwRDZ0WyiDjMTFnLRKRw6sK02ph9cZnMe8fZrmsJ0710vNY0uY4QFbSrzd" + + "WY7FvR2oW0ZI0zyUKMETaoJFAUTUyWuaSjAQt4DbxyqAYcj2ysQneAWKMQAWMoBB" + + "hIT0HPY5ne8L49gqYBFQhCXlCmzuzQImhRcjCApqiwAmbWJbzsY5reBB1xT5l5T1" + + "ybWy6V0tnJKrLM5WHNy+RpkM2cyZ5hebCcdg7aCc7IdY80lCFwSGCAXNmQXb2QRQ" + + "x7k3NRDGXELYQ1gsQhhUDum3ZE72ughHRdRDe5Te6qw1u1LB7lbNrJow7QT1uAV3" + + "LMgyxdGjCMORl8Gn2BQuwIUzm8BtHWJnZGBtieoICDTvKJbIMisQ2U1BCZoZlhQX" + + "ygQBW0jtgQdslCYNcrXVNnBA+zLTmqmqYeS9YapA12zNGgCPsUFmdoio3ByWaNXs" + + "7NrZuGMrSZWRJA0vOHdOWzMw8kjKrskdtyHLanDtiyJzpWVgjo+aaaAkqTKWLcdw" + + "xANHQyoZ1XdCK2biAxFgjnDMsxEk4wrWTKgmoae5DQbpESptb1u3Dbpe6qOAZBKa" + + "UBJKBZeiCwEJ0WgjFAInS4JGF6SCWBfA6F3ud3YtJTVontzKvsRDk5lipuE0+KVI" + + "KnHbGmhhDdShYAZ20BJi8hNs22nd3MxNWKTyqlNVdr1vFs1kiRRBRoZYJt1SAw2W" + + "IVY7gXmtBFNaclgFQFjwnNh/g2AZt0p2YbFHgZ1ZkUHIuCAEMTDITBEMBgx4Ecgg" + + "OwyuETQ7GUQsGRFZENlWXORDAZBg5I2Qg0CU0NEcuCVhf8E4pyCmHivNaJAP8Dg6" + + "HMU/BCCcRX/CAZi3FTsR+gqagg7gfXVQF3AFS45ig+iMnICOKROLlQG9QyjKyxqt" + + "rL7DL2NWEoOARpsJENtjCQigyaiVbD8RcRpvD0dJYxh4KmINWGAOAshCD2ihhCBU" + + "w7Rz2iEeFpgIN0kKqUcbsJC1I9OQR1ARqIJlDBA9OIaiEhhK4RqJxpaG4HNX26+L" + + "L2uVbzYr6uxSpDYDItapRNSDSPMC40zShplaragEHVTTzmCYzRWDaG4boqxNVpQe" + + "/U/8feVF+H1z3Iy2hnvDyeOt5n1QI23zarZHe9m7tUTEm75vIImeGztcNqf8/DK0" + + "7AS3hyuujbWlvld0RqQIdaW8VAyyAqKpJUEU5BBqICLiixEH2fZwoinThP1ruaww" + + "Wxs79RpIWIc1I6VkHrWTkb36HKsT8aCEdYQp8dyc8nHc5Tn1GZ9DqfXs+w6jU5vi" + + "5KOwjHVB4s9RJbGxesXpEnueovCTuXRSXfPMqMjxq9le4We74avJg7nrh8fkY4r3" + + "uTybuqrI5WCNRuBiLUVuMAR02HDRwNFmhVQC0wOxtAjoECQdIAuc+ZfaLo6O0IVM" + + "EV4FEtlx4W2FCCd0Phvqkylm+T5VSzgZCqK7UNZc+X11LEfD369NnPNn684h236W" + + "bTiIcgobiiYguzQoGj4YxXj++cs4Tz0qdHkwXXYuqOxh4RlKlgXcTb+ZT58LL54/" + + "X5UkWd6UwSUtKWg8ezAgn3LlVGy99KvHea5jdcQUuTpOwzdqe2VOu9t12gz7+79S" + + "tp9hZGnb9KZ0+UWVGOfa8PL8MePzZ2jpXPc6c8Sz56UZnuR7VyqryWOdve7uxH+f" + + "7i9zTaJuakt23DIbPPKW3WvwvI5hyr5WOMzSpMgcRs3ZkcLrNrzmzOP/kkQSPs/c" + + "fx/623+62xX7H7t/15ZmW2yT/C26fxC/1B/Nm/4vHf4Y/W83vZdxnDDNatLLf4zJ" + + "2SOOSTXtmh6bgfkM/aUg/9rYz+ROs5f0f7Np83tXE0ON27ynOf4eduzHucnkr/bP" + + "/xPo+Tm1N30cm7RXZ2cox/U5Js3cZ8ctGrXWkfP6/AuC4YHo+wmtGj+jDpRjOnhC" + + "Rui6MS/oi+aX3Nt6cccYzh37RNxmjpw854P83H24dWtaabtnmK/F6q09XRzP6HOT" + + "UEd6oETQUHmXUt2toYLMjFiMiAgDhaE2Dii0fPTcNGH7p5jf0kPg3fXkttKDMGej" + + "3IKP2KJOlt/R+CT7PcY3AZxsoa+WREFD5vk4TdXR6uRq+MzKxSvDrq2ak+c2275m" + + "d5ettnJp+4/Y+HV6qxudXLdedt6uSdTKGaMJP6jNbZZww68/M8PzplDqYusu8ZQB" + + "AFQUJ8y9CB2DjMriYXiyEoiFRoNAmCWWSMuP4EvGSYUfk7ut8CD78n+j+iqqihWU" + + "fmZb8RVjX9LiIokXhgfqc+hjbZR8xHTSG2NvltyeEkBoz+i+EBqwZMS3bqJsEaIa" + + "GhUYwpTgGQIwCHFSPHf9PH5soVQwNtyu3LdB4H7h7qHvPtJPgw2vhhBmwPscrZ9i" + + "B0ofZ8/K22LZTR+R6NBmMbWj+o8N5NK4btPxmPo3Yvl53M08zTwps2Ux8n29W7or" + + "ecnOTH4LDyKfk9eenmurrptb6EDAylMSyCFoPt68A+P2W2rxpvgRO7eOTE06p78T" + + "pM095szdT5dJNkqV9yvdk2KjRq7ZNv2M/zD1uISNH5LRt2dPbXxwgg+aSTdJarr4" + + "+t4IO5+isaqdYSfl2IOJ0ntA756tsBY3I66SOBHlU+0+8bWUbHdtxa1P2y83z5Pv" + + "NqJ29h6ymz5tztPN04yw5+OsUx767u+t4Wb68vvztvPsCb27OnbrgHffegij8Dbt" + + "R+cpqFnrpoO2jCj+dtrCBfwtFtxfNrZd9ZcQzVPa9qbeq8duMYmVfF+2cTONb3u2" + + "m+N7LwZwK24TMUPA/s1xS2PJ211vg1JfBUXQLO2tMacGtLJmttPE59YWnForCNrr" + + "vbv4+/xy7+NG7BfXbnqKVTuo0DMuFW6c/DBvb4i5+crr56qLSmCHWi131w0DRNem" + + "G8J8mWF6/BavOE5YJruAqh/e19oRd79a8j2xXHhVteYnEW9a1AvE2WHFHnr7Wf43" + + "p9q/GjSGtZb51XBDR5fZe/afXwzt1jTi0aTqd5pQ9xPS9+tflc68V3+R30RS3anM" + + "Z7/OYoK83au2vY962u/PmnmvWmcymeWxxPne1H49bc+va/KVHaqJxTgrqcN7zDZ2" + + "TweudXvavlknvqpsg6zC6+IavvB2enbrx754TjNRir97rpG62S7VPnth+nn9KvmF" + + "thTinXkTrfbYcr54eVPbFQRF11vTW9+CcB+4r3XRpMtsKWHnhn3dFDF7PYpQoLeU" + + "zh639UyDF5ouhQerfW+FKROlO2lJwm+UDcwvkjwQ51nx2aQ+iINt/lkDDTrmb2vr" + + "xryHii648Xu/tF6QHbUcIFxgYRp4+V7eaLG64b2su+ONNxKEDlYjMR1Fuhvauj8z" + + "eus/aeYa2iB/Va1tuuH2zjOvxxxonwsbYInfrnTPNs504yedSRkJR0jeaBvNr5mG" + + "nFr5TFHNub0FVE3034E+q7tfF5n54uuT4o+28bYpzjhtI6mfB4jbVMEd31VAR4vi" + + "GN8Tu4umaeq9qLGLNUsvpQu/8faJd34UW2pXhjvaq0NFmKDNZ7UjVrNM4aXvd5pS" + + "g7LW/5p7955Vtvf6tsMfFl9rs3VvkKnfvemaXnFPGd4je+Y3iU3nXv37xz8/Ot5b" + + "nc6a2J+dPSXnLYpvqfBk7ZifA8RiUeNNauSKONwZWKpMDsKhPt+f5X25+dAjco/6" + + "X52E/Ys3128FfCeI+sV1Ngs+8/j7+sqrWwKe/0ydfK2xlW+++7Sx8Nr09NQEOaq5" + + "Z21TVe+3euawND9LPk1eaTWOD2M1bXSfq32fH5WrqCSRodPHmm85a3Gq8/ldR8zn" + + "NtO6s/E5oRyyZ1pX09q7BTxk/n5j1O8Yr8nSj+qezJTO/bzuIo9vLwYbxnRYVVut" + + "OL7dQJYPFNnRyNDLjWmONtQBd1AxDZA39o0QEps8eiBrSOQO+M2yN/b3A0Mr9bVG" + + "5A42A3LcI0uBvqcxzal1tziFTfaXakSnUaaNpTxpS+3avWO1hvyyUtPUe+uu45yi" + + "4aeNNM2GnS0nrucvjF/OGhoOnW1aB+Lxnmzq3GyztaXeuQpomp1FUXt7Rffavj8e" + + "Jxqux8eyex3ftOU4rXxtxMYwPRqwXX3Rcbx8dn9s3YtPa1XrnZx3dqikI3E1b3fP" + + "b83aGWPme0CcoGvA1o2PWLs1K+ceH4fTFuVHzrGWGpHci+dabeFi0V6m3aE68H73" + + "Zw10nviGOyJI6DzqzFDysrN7Vt3elS/jFreqKx+UpRu/mfHbO2Jz7663zp9WvTov" + + "vvvi14Hr7KrTbRduDN4R+UTmqrtsy2L5ZVHyb3Y6t0R06bVXuuJsOJpv5TdGqPBn" + + "vjuRp2u8z2WyNdKcny5v9uOfk2vv7aaeetW8z7wtz15nB6WenehxSnftgbkj3tWd" + + "Mah+7rRbrONx6m49l1arhpoQIQzabRKaTwFVPoKPOmlsaT9tWeFUp8/XrDuFrtXT" + + "1Ap74Ub+kFY8KMkmQ4I7OOw17bYmTediZ0ZtqXZakoO7cey6d0rpPrCrpmfgHM/b" + + "a7hjUcJ7c3OM2GCCHLLJ9KNHOb1c199tbZc8EKX0o9vETvYazOKX1tnTN9u/0fij" + + "7WpVRTrmmb7c73x2zlpOsWq3PBNjMryyVim+k6qIHV8cZzrm1NNNtGG3WiU222+q" + + "WvilXLVPDTtuujYqnq92HkjtPrnhn8wfFVRtPKbMlam+ja2nZNWzVGx40FOJoI1m" + + "jzX8RMGuvpd/eu+lF81TFb00pDIz9nRKTd6RSnvt2s+s7+qqt/jhaRHwyffKQ/z0" + + "/tG3K+dUXivrmu3jC03fjSsNvPfd9sob+3xr8iPBlBljpK63v6fnbHtxKpDNFNx4" + + "fWXi+m1XLycVHAWwI7iooCKfX4XX8vjqgNOk/E9udJqie7fMu3gr4Snj7XtqUiPX" + + "k/dmGsfHvAp85erxqS/xs1bwlgkOcUNz9VxavzsJ6RvKmczE3Qfa3x8N7dfP19fV" + + "5zBafd0+t4Gv1r9dSf3T6+afWJ0nyP0YagjzqAokAsvA5HMvICycScGRH5DZSUA+" + + "4yHCgQfxOdfUK0SiI3A5uCNvta9mxHytvJydnbe2vh3ekY7Rp0aKfJeTkcPDZ8Nm" + + "PB3NTaen67W1s5nLDjLOzJpdra8zzbuJp5Pt6W7cnZU5vM2/Y6dMPz9e5Tcsdwed" + + "g3dJ1jb2DdpxJIz0Z0kNPqBsn92/s4FF+N/glGnYgij0wPhQuH0EH5P7jwhh/JyC" + + "zw+Z3IMdOXTp3K3ZOHCvyezHJs5atrTSjQcMZLMtxWHd4dXKNgxw4aZq3nzb+1vu" + + "cjpvN/b6mqqpFQxWMPRn6H4LFK8ID7PD0s4SMs9KL0KMPT9CxUqLPxoSUfQf0KPy" + + "Lhh9D1vz6H9jW/B0emjPs4eCR1R8HP7MbkZSDnGyW2fQzpoFHCz0g/k0/c8XzYzM" + + "Xg5v2dmmnecnavJvG6+L5VVNPmrir5NP/86vZ5HJ8Nnbq3mj04tjyV4Y9nm2eh0f" + + "qafNu7Pns6K05Gnm+zfa1ps3fD43tuO76Gt3pHDu2Z4fN0c3eclcM5W46KqvgrfL" + + "ZZ8Ozk5zj2t+GJ1OZux01LfBLof2MVLIb+iTTw/Qko8MWFEI2oiP1WGGjYyKLrbb" + + "fh6PuDD7yk3srttD0dPqECggsURwgcKHFYVt9Z+a1C4nm6Upa9L3uLtW7mx0YcK4" + + "Kx0dfZa/Ltw8n9hXZ89reu1qDcLLcHUQNwHtoWoGtuURwwrIGERCPzCr0EbZJDNy" + + "QYwp37N0hT9ZQ2foLh0PmQ4bKfLwekfRti0fBA/YfU4d3PrbbDZ6xtdCy8gjwLiJ" + + "ERJhI2+1B1WIF0FdF1DCwjKkl0UI4z0M6fVMf6venWbllsbtgcPvILqxNlq6efK2" + + "Sq6vRw6K51ebu01V9Z5ui4IUOJjUBhQUeqIhoDPBJAf0TLYPoToLip4WdGkzxt/Z" + + "762yzA4Qhhh4oHIv3KIDT5KmZlTKwtaWOeREM8623/B6elo8Q1JxiWAgQncQECgM" + + "LAiWAQRUxWNHd3dxdjkaybr2VslNjq7NlVT2j4cJ2ejho/Rk05YtfCzu1xat+Hdu" + + "91cvNxDspIbRFIVURFCyHQYewlUKLjAgdUHOqqFXQdDAGooOZKIyENwSUKq4sEFR" + + "yNRMUadp0PLpEZlE3GfqYaDKGQcHDf7nD8kmHDRh4fwWWYffjxw24caYWfk0mkeN" + + "D4SFGhHiVFbu2EkgtHFezxIqaWnaEdzJFsqSNEFKpZXphid250aNmnZo7ZMVlx7m" + + "zFVXDo03KvK3TTdqZZZ0j34LqeGyvh6K8ns4bdrequzHYrNt5jMmO7tq3Hk9GTU6" + + "GMOGnzTTgbO08zq5PJjdy74zObhx6M8nJu5Vc+Lbm9uVj1ezk3q17t3D0exwYMKB" + + "pTOURDWRGaXREECYuJhxzxhETUu8mXv9Vjp48d1lC0/f0WGgxkH1HjiPyUUeFBGO" + + "am8bm7o07t3Vu5lah4OzS3020qqBK4ICgQPb8h8fj69n+3hleET5+1Kk1maNSlav" + + "R9c8+++/Pnenwej1erxtb6HV2SCSSdrJHVYHikZUg1ZVkDtUEypDVQZTN8kDSwll" + + "keMwS78akNOMiJQQc3dihLlKj+oCG7aEM7oG4kZW1NVLsxIVjJxmQMVBiUTaWsgY" + + "DYxiQYyPuBXhdUKWrZb79D15ra7uMfLW1eW8dXOaiNhdxQslkuUzMFKgagC1Ehom" + + "iOOZC4AyO5qNxXMVogEhIpqSNRe4grNtR7emHctEhpNtsXLSm9xOTBmOSDYeNILY" + + "2DG2ibk3hUFnKtvTMXYBFsiI1xxoHjiBJg0ZhC2Vig602I1PKTNWvbUbYm/JAG0U" + + "aUsNNFafJHs1SpG5rY8UsGwe7VRhp+PJFmpjr15ahtvTFpqhuKWCg24WKj7kpybZ" + + "c6V5CsG96jMayx1GWUOgDVCIZKqhixI3lLuejpuwX0E8/UR6+vsvzdYqEqnmqYPr" + + "ynyiMGXW2W+XV42wNasYmujHR/B20ne7B8uftj52a23ykGf0r2Fya3xEEDcibiTQ" + + "0lZLgyC2ePfZkNiK8bqa+t/uN5kVHlxN3dckC7FJia9ve/Uugg2wm6UBkqXOGuys" + + "qBJmITKhYQIImk5o5EECZQKpHrRxXGOTi2LXQmqWh6LhdyTi01SqSQ3VOEDXmHyx" + + "eGS7oe6mzQZ5CDD00rOtqeKJjKBw+ee+cWoiUVDVLJ/FhK0iGh1VeKiES0TeYm9Y" + + "aEWwQmDQoQiRwvF1pOMzCkqwS5CmptDqzik403jShJgqi2UaBbWZmCIlgrKzuoHE" + + "I80UvVUMTR9bJIWy6iiIAxXukg2P4TDx8uds7uzmTTj2cu9+82j892bLO1fYjuV1" + + "nOX+0ET1+9s/q59/SSQJI/0pffnnpk32yWNNLZIyLEInER1S3+6lv+L1te04VnqI" + + "JI1eRIDos0ygqI/u84V/ySnvUfr5/o6avXhuP26/+dG413/yfDY/hOza/3m6353D" + + "FQf4gPLyckmNf0/Z+79v75+CaSQkY8In6aqSH03WX6Z0X9VQB/vFWq6C5csRuvBZ" + + "nX9ytV12MkIm7FR+DLJ9H6IBOuiLogQGQ/eRgyJJAx+aYLFFoFE+nXZEmdeEk51K" + + "K8zR4ejlk1Rjyd9OlGOU1IHRC4Twt1lj8fuDSl+toyn7KlPBdN9GfhbdlfyOpi2j" + + "7n1z3jf4hxzT5xvpenii/OQ9atPRJOV8YpWSsyBkCMSKpoqNVJ4qi6kbGS0oTp5U" + + "Ze+1/H5LYmU6Uu362dTHpJsyInEO5DvTRhC0noXDbUrY0aAqh/N252CZJLYxRLww" + + "eDIgJvhTpSsrEJ4SVDvd9S6BwlgfShNMd9KmGrWk3I52ZEqkIKJiiDZgpwVrTuGm" + + "0Uo/ZLXM3bFdFTPSQCOxHSpDGrWnDhd5Y05Lm5qtLILG02ERoixRXRkaboZjM9Fm" + + "XShtFC7OcoJwLVrbJ2vpmlco5wxxJm17X2pWtUowXbS88ViaVfl1mbDdKMZhHFFV" + + "CHEiCc2ed3C08Xm0T2nd6Uv1K0yITQlBsslUGWxQP4OXJVEfYPWUXA+kdcuh/+HP" + + "wWUH7diyuFPB1lyF6ZrDIprJE4SEZ7msK+k6P1h5hh3qskj4roZNzZTZjCbg2ePa" + + "UWtQoyUuGzm+j26e5Sjd6d8bPnh8J/3oPU17aMyljAcLyiBhr8j7ZOg/Q3IF/0Ta" + + "f6XwNY0RdbAzegLT47336Ne7qtUughSk2m77D7Kk/viknCAADCufnfnmfRa+PuZ8" + + "GbDsi+jRFrzw3ixPHSw07DIXufXiw4eHq9LyQfWZnFx+S0TQXRM1QT6QbNSZJj8m" + + "7UMbjp4V/ZPnp3lbJ4dvxkSfH+zJaG1+r41D+t7jCD0giVFEsaiSGe8yzuQcIPsg" + + "7JTIOFnT68Mlm/XtHO4/DVboellFEFwpf9tkkmQRHs6yXoRCkuKPxU4Z4SueGdIi" + + "CB3cE9RKuhrCdlwcyTChsiIXrJwrTvs9M61zkDIsOaTPnYckuRlvrVGxZx0zpzzt" + + "8L7s4WtdLbRACW2FaHvN2uU7i5n0qt00Kgy9iK7Jba3/3pNiLNMrM1XhIIBPZHET" + + "RypdGC5pZhk1rtje4i3zM6TWPeYQEE2ICad2RgNnBwoZOXY1T9NwigxKQAH9P9Hz" + + "7gx+I7Cg/gWYSkB3Ml8YRVoO+7qZcd04606nOv7+wkB9/5D9dwJKJD9w/pOUxtmf" + + "p+39YZxm/5BaSsnQxtYbRsXraiFwqdRNWIdK5L46DjXUSMMKSKJGX16puhl1MLFs" + + "NjnoaUBMXnCJ+Kus2EV8F1F0KGG54HeshTQt8laFCKcUvV0VSQaPOy1KydMvj2Ez" + + "AewDB4P7DzDchscafa/a6vq62dZRm3G2jIrBxhr3MevBrYhskfQQhIEa0BTQhzBU" + + "xFWQUuAIPIiFQc+2IfQGI/BwLEPA90bT/w9O6Hlgj+ABZZYIk4UKMgIv5BFETg9o" + + "QqCd/YV/CKsIEgWiK+Iqgr+QaKBHSWPIIpYAYOlqJTAzWgXcJAWQkSQfBkVzkTkt" + + "EBuCK4412dduYOlRLbTkd6BOG9mJ3lkOMIivftOjRKpUQ1n8N8AXRv85sESi9I3B" + + "wqNAL+SbEH87kA4Q0iLxfAXQzIiiJA+Dio0PfHBFET4KwoGEuhuF0X0+Od6iPDZB" + + "vqe2ZbNmwwwQNnblG4ZREfEADnQldENc+vyD2hPFPDVaTmO6ErcB2CSrJHawjBeT" + + "Lu1HHXecOXpfFifajXzf803to/li3IQraCMnXE7aNaF+UhNCJJ6bST1yCMSEkvrk" + + "EZsiJnq9YnIRyfoE3qs1+5g4qCjgAB/d3LXII3r+NecgG/A/EBhNc2cEhOijxJO0" + + "FJewHGBzK1YnNiLkAPBkUztU2GMpL0j31B6VEaAuiEtObw0ViA2Qo2CQrPgdgapv" + + "FCGKU5zwAX48rSmSGfCh0sBAp5Vw+mHYBmgyfBvQ2gE9Qiw2eCK950Urem/KrOD7" + + "tAApA2iLxtGRmFUGVZgNFMIQi7APICVtlUdVP5fqGLX9TEJBSYcWuJiEgyD+whr8" + + "Qt4j0BCvhFy3AUJAHpE2ATCfY/XP0YM68EHwJaHTWChL8gPdCT9IoJW04ShPtj4h" + + "rXUO1N+9eNBzh958PwJ3onum3eftLwTIIDagDw+o2Baej5qT77qlol7lfPlQODAr" + + "7Qiue8ErGKQIVtOQ+yuebQ9jz0QHR0XSF1f1oB0wm+nhBsV5Dgxx5TjC7ifRJgWQ" + + "JQKDKZ5QcF8aA+2FRB9siyFbQEtXEFsiyD1KeYp4vn1kdk65sBN3fx5t3nO/Y59A" + + "R189AT77u6pOAXgcINOFPg0rAnT4ODvDpDvB+Q6AjhNjrJ2a9VBRzOAGZ6eDgd4b" + + "NoM0UeBxPD5FreuGt6Dwo9RFdb8nAiAa2R1p49xif5Sm4cGGg5x+6ZreF2MUxiIK" + + "+gryR/PfnDI6Q9Gn57KlMJ5766E3pkiWtHqD0EedIKlAC3QaBfbl/j82SCLdu7yW" + + "v6Hmk/T9Y/qXglgiQ/aIREU3sfkhFsOhToBSbFaUQBrYeBo78wWrCIiT9D1wcVo4" + + "GjuBz3joxqZU7bQDFwmjB5e74MBLoK0PA4QkclbwijNF7qEEoFkFRROi0IZfN0sI" + + "zwihRtDz4T7ibJnxZdmKq4qOeIUAbh8KmERXb9nKQ+5QdzgDPcJjvxw6bZ3TBIWY" + + "SSeN4U3EZkhKxct8oIiTDi7lqOt3Kvi/tFCQEsImhN98ZBnWjLEBK6dw+FxgB1I+" + + "dDUAkMR8mm+NWReOPvBhDZjk4boMpjxoBGF5Lqkt7tL3kyTUNCK+PoZx3oUqB7h4" + + "5wEXO/lduTg4NfIqAh8ZfJSAcG/jGkuHA8qr7Ro13OwIJLia9u+yBZ0dicUAxwCA" + + "kEDreMjHsNGLghIQjFyrYc98oQaGSKediKrHfuebY7DkhSaKvv+X/oH7Ij+oKSLw" + + "2kgfoPv0+vpfWeMjRqQk6L7QtAATi0oNZJzgYxP1w4HgU8+oYPhFESAjAyvt302e" + + "CDaAWgGAh7Xub6oUY6dMeNnQh4yl+Nm1AA19panR4CYHnOGiidVdfdsdGvhv6Zx0" + + "jjJBqQawcqukBR4Ux34pXobqCIL3lHdgOad5nLqYjUZgE4QvtAltbhvPRFES+goc" + + "QfyAkiF/e4WiKYNUIFjKWJZA5fwJczRRibFGT6zCHofhgW8eydxvZ1UFHu97Toow" + + "8FguNJpiKoCc0GQAn4ceHt3K0i1feYVcihrJaNBCZJgh3FO6ENqkEW9eLD7vi6wf" + + "fT7OU2J7Zn4VPfXdnohaADg6HCzQSKlLKttUpsb9HGGYyM1kdbG3LRyKBaAlAEQi" + + "6K3SwEpXNuY3BAQX+wSMOhQK6JuJ9BbiQxBRmAuim0FUeeYULAUKioFQBh8aR3Mo" + + "71V1gxByA7oX2gGDQe8klFNQQNSjx5kWPD8XwbJrOHhrmPG1eVz2hyCeCzw70QRm" + + "PBaXfmHpq4d6Cj30CwL4FmzRhVE1Z3PXGd4oUT3RT2fXIk3Tn6hAxuw6R4ZKzAfB" + + "E2O4JIhAk0YDAlY3e4AHkEgAr74ycQwAnQW7rtlcpF6JZA7VNu66JrCcgjUCEFCE" + + "RpghIiGj2TWA7EMd0aiCjpcIQOLL43hkAKrIRD57bdINOGQ01LwiQc32iwDYCMaA" + + "kHwImA5vu3GtiupPVup02YPe4G+iICJJzomO2gryY5W3M5zx7DfU8YCDsEXiG6zV" + + "+xuOJIG8KOYoQjJHHsGD13J0uAvNmGVfCbv+KJrzyu7cZk07DszWZjii34Z5Oq4J" + + "YoGxovONSVdyqdDaiI5o1E9gZEO+MOknbKrd3vCGjWOSCrnI7Ux2qgrF1ozkJ12i" + + "qiB+Qq2iQl6eKyIKevnnG4vy6vIfKJt1EpCX9n+P6PQpAeBRKJQ1sOYCWlkXAgV6" + + "zM7YJl8sa21D2vb7geeO2SpmkzN+KTwlzt0iohA2AcDPLw1FWDBUJvFW9ggVk6Dx" + + "nW8ShTWwRlT1sHHJyMsXFDhNL6q7kI6WJJzpELbUQNVIhmsRVy0ajWqqiK9NrXLa" + + "rEhagikVJEOvbHSFh2axoim1j1bJkioWVpJnTIwotJdInhXvflf6SU/PPQX0bTPh" + + "CdsP29ywEL0SWUfTCD7EJL6ETkKMZq+XfvOV9/V1w3yP6vw8Bs00Num+z8M7mbcc" + + "Nyaf49zDIxUaQ2EvqlaeEBsxpWMXnJV3xw2Tk85CvjXKxcvj69eMUfMr8bW8bRbU" + + "onKyW5YZYTLbI2sO+23t750Nk8klcxbgYLeIcQe/QCQJFkWj+oMfqaThzaIrMI2P" + + "7OfFp/TvReP9gGjSGXxEeEVFAmDkEvv9VUZSkBPbMF8w/60D9GpeH1QCFw55QkLu" + + "z9IAXDqKnNMEC9ziBCmelf4wfDqr8bOBhgIc0RJII4qPuV5Nz9AAJ6ARU+oPi6hT" + + "+q8gwvYgoidW+M0fbI8rtLFtXO8iTUFlJvXeyFxmJtnkC7zuiaT8nGztzQSqBLOU" + + "ovW3gp+vzfBxm7PhlVblQM2bd+/Rh4dPRBvEDSXngueiAwyDAY7g52aB58+eG+XC" + + "rEW8lGS1QUeWOAT3cakjvwRHNevLrWRGxOBmTNeUHz5BNT4o+AkxZAgM8CgQuYt7" + + "U5ikqOco13h+zN5A3dAfUbWApJdeQtkMkEkG1iAUlofiG95daxu0Xul4UwF56lZ8" + + "3m8LyQBioWOMnxAZw8H19FHnTZSfCQ8UKukI6IKbgi2EROEVBFDkVQRmNCWiK5gK" + + "gjqIqofRAygkWCEQQOEBE3AUBUywFE+iCoPxHKo4qQYSR0uWSDgsC3LBC2FUgIbA" + + "gEIgr0IFBFEV2beEGgOV2VCEkasTeUI35YWoqjQQJBJsaVFsgnIIYIegAZiYinAC" + + "KCHIB8L9aSU2jqpgHDRm0jioEdaHayC8iYiN6RSgqyRLYbpYJZUhzsQdYEVBA3EU" + + "HoIwQQ3BFaiKBRPagNKp4YAbiYCICDIIOliTxeOOGnL2EcaOMNDMGJjKNGgchDj/" + + "BKwYSZqRlgLQR7nzcAWpLACURHNK7oqAsUjajiiYMTUESEVX6ICF+TFgwSIL3tKF" + + "+9aliQFdBBB/IK0AryCL37njuaj74l8yZNHN1lSjgfcTgmPsJRZVGcrSr8IEjldQ" + + "KtmKapHX0QlsIki0IuSRcABgN0Gs+4HbDqPIFBxJiVh3OSukGiQvd5nogLDQRteh" + + "2MyW2SI9oRhikH4T0jXdxNxJF2Xnskl3AVffHjA67x2y8y73Yo5mAE1DhsMmXJEc" + + "XQigaZcogCwOAJSmvkK59/AZt5r6CHoKYtZF6XRWBxO/0HFiG/lmwBS0IXvAvwXw" + + "uNK56cJCuiEUIhAnVsVC0oQ/LDomFtpZXfIu324pRnto5FdNUA7OBqemCvdxU76w" + + "rnterFGPG+6Q45tXnD6WRacT+nbNIk1JCPpi9vz6KPo0aWTYVCFR78pPNQgpwlQo" + + "7nZl96ldo0qhd6oAriD7PYX3YjYi6+KtyURx0Dh5o389ggNbU0B+KOiBJNO/YO34" + + "6a7wfKK5PBjVqgozX5yrvYe4b+g/eQESyAJYADkx6QeCQZ6hHDToVxoz61c19ymI" + + "QUB4ySSEGSTHhMs0Tr7Of7v5ZHrYzWRqmxy/D2PVnfrHr7nmk6vMiLt6Pfbbft76" + + "NqFfrnncwD0EdL8qWqmCRcAGdrsAgwQV6XyemW3csQRzF17hRM8sNaA5u41TovvJ" + + "lL6Jmj0Qdj3rXVUPYlIJEIbMcN6Qo+y6+Gy6V0pk2Gw6o2eXyfFnBOzAXCDYADzR" + + "CSnRaQYZ+hwQZ0h7sXXIQK0DQwbFchiJ7Akq/buuqEJT+FvwSPhCs1JX34emWkc1" + + "+0JlH7mgV6fdrze3n1BaU/HP0Ip6Az60FlmH0F+FDieRNSpsh3JnZieg899kMapx" + + "A2AgedvbfYhjt7fwdfgTf5O/lUCeRAZEpJHwvsvi+d3wMBEna+Z6+GGGgCoek/BW" + + "dQo/JYryYiLihedIULrmV2fAYIU15yOAfqwHuI8EwYI7aM8kO0X6aYygiiUvGaA5" + + "AqKrb3bLK3Bu/ws6awNQMldRV/OihvSGeGuLuQ5zhdKQyvBbunGHiqbSVBLCBBR3" + + "sJmkCunDAXHHd4eQxhEGRYdBzZu7UXXMiBb3M0jRVaMN1xw04qyJ8G6DCyAXnHwZ" + + "RDcJFX32jyXoosS3eitAOfuZFfqdLyQBCCB3aIfY2OMhjfbVA5gUvI4NI0ulOm0b" + + "1FDfrFHR10hZU+ODKMCViSStxuklLxyrOzBrvpkTD7nncH/YWN/xZ/cWB4MEWMjo" + + "uNq+pDjINyCJIMft7GzDNPmQMmfKO8C3BCupq3ah8aC+3PLydaANlYxbybhnNhxC" + + "RTyS5wfe8lJ5C60b3pGVdQBEF12XTIjMtk1B3sJLjW843JTV6tmmB3szzW8PCNWR" + + "3yd28o27CnITe6LTd1rriEPv+r+W/Lr2jtO7uzN3c4O+Tfc02jcUkrJR8QctADA0" + + "gXSiA676RwOkRHURdCHLXIqelq5LOSTVlo0mrcKsbgjhEjApzpaorkBLDgWikaMD" + + "WBmkEQLF3ZzJGd55Vbo6iJbSXTzOm0HEagBiaN6SrGSjgMe8kJ1BRvIDKb2rTVuv" + + "UjayCQnFgki2WkEJGRQCMRewEqK/x1GDBcgGSKNrCGtI59lyNKkdOrQ0UCJT/tYC" + + "QsXuKTErgmB/L7qWQAgjObGxtYRpoNAhObSe0Yb86I/8koc5eNsi+mHWzWtVmg20" + + "+QHoAlFmGJHkyHlQ13uGhptHj5jDJQi8LDIbkOBvKk72hX8sJ7ueW16GHGq4y9iI" + + "j3yMYtSIbDhrWwlmqZXVJRCqouUAUhKKoGCwqjpq43WTfM2qub+jk2T4GKHeyOVj" + + "tYdlk++2vs+/+x5NvlJOLPYmGRLWSHhDrPt8vLxjo69Xl+W2ESbJz6o+epO91qFW" + + "HfEcnfU/36UAcqgbZ7xi7DdKjmP6OdAd8+vBt/QtBnxhQ5Y55yjps21VoCjTyYLL" + + "1CSAQTQgB7K2FHCvBzdvNMXNbRQpcZKHabwUfuGc374PhwMYpCQXoDnJZi+6wEgi" + + "AiX71dMRdTfvYRIwt14Tk5HPrJ9sRIYwCUOkZlDd4TvtfPdgHxB1w21pzT08CJyh" + + "7Xc8oYd9ZaSpdBvqDRYUDhA4KO7b0HDw6Hwa7XttFLJvwUIDpRXAcDIRWHS+aUSz" + + "xocp5qowJUFyIVcKHx7WHevE5XHZxO+4peTzkklyu0YuiXbLEIJQUcsg9pabkI/h" + + "od3gISwZ4fwv1Xzc/OeFHgwtN7OIIX02fD0/FYKloiIWHTB7PYJwBsz1ERDlrZJE" + + "YDEhYassKO0HhjnoW2l4pHuKoFBPAi0IHcnEsMNIUlBMw4wqCkAz69wRdbCpCqYV" + + "IiZOnuCR9k4a5ZjWNKYUSxiFzpNQQUVwU0iIm9GbESmCr3RFQr1Uigjc4jisu4pJ" + + "puPoO5yOeZt1LgztDDSQtUkU+DXS9idDpAhOhoTBeU7AAikkj6CLUxCIImIIc+BM" + + "GVzqBtTlqMISI1Sc4AgyKiD4gcWAivyJqEowpHETkhIOIUiJAsq4g6inSDsxKRWg" + + "Yt+3owIGgQI7FgKRip6JhDOMYUVRT0TqgKJELhtSrt5BLVIqtKhEQLggZJ4QhiQR" + + "Gq0Cqrhtk6wQnTdrZdiQdLJbBMJNwoI5yOuHOpAbHCioJ0J6YhibSGY1HllCJmB4" + + "jcrMaFD0ewXkW4ejjFIZTGKo4JHcpSBBPtd0Qxs1vmR1w4jyA/Q8IHSlHwHq+Ee/" + + "WKYiGSG4HC6NiRUCLF32CGopcnwE7g8WC7D27ysTrEzHoRC9BQyGYAhkqhOQBwpF" + + "wUlY3keYQrRXorRFPA+GhTj5pDpAE7BLgAlbrkDpk7XdBkMCe7aC56ythMcLyB5M" + + "qB1IiizVK6jgSzmXFAgGIgqwIgA6EtEewNxEDMEKsvoUzTnlKA5iDnmtY0XrFdi7" + + "oO1avSIz4+XbDYhpYNbXls12lualldWW6Rmvp3XiSn4tr7H2DBIdge2UHx5TmHNI" + + "B0iD6NlFC9gO0A7Si+DLWvYUsE7DYKO6BRETeHLcg6SAFuaZ2hO+UAetihqZiOFA" + + "GI9nCa1gvgaJXoNNThLNEDOVQpTOKJxUxb7ouRUN5KMOSuV3bdQuokVEdMKFDQPm" + + "AmkMhmx1/f2bHBC8ijYJk50C6E0XqgwMJ6K9wOKaAATyGEoaSjjPogj2CyAOQRZk" + + "JxFQViYRM0i+Ei8gAZiihW1WUkg7JgoKGBijbIMenRopoooFjRhdB5EbkD0B3K05" + + "69Q6zqcbkOM1FpwnoGyJMqYsuqUojv8cZ1sKM4tO5+rCm9ZZJCE6fbttA7APREM1" + + "9CSIPRp816UCN9JJBPsHGQVvYZdivqFy+EDnwVAwp4cGED2KJDVUXA7yrAlwDiMK" + + "5xTOPCYrIplcSlucCUpqSpZoxggu32wzjnF2FlIidoAllPOFbJzD2SICWniGwEiA" + + "3QNDcV1ngXIKepNW41sRWLhvPSg1vwFIhjFd0VnVLBR9WMhksUIIoiX6b6aI6gwm" + + "eWGTazqFhRbYz6BwdaC+k9L6lESGVK0KgKYufORB0fYYzTnBemj4BH2gEaHaaIrv" + + "fxwDWvTnqdY6WgKUpgSoZrcEXkiQwPFhy9jFIQUORTJpUAFrhENwKQV1OLa5FQdh" + + "FEEkFVhFQCQVCRUlRhtibMFYg7DmjWQ0vBThVntDVh0KBEg8z0VFZ1dnlwvOxCyV" + + "yFg6KORRzKtb9eVaU6PsPpQ6vqCxMQymmlu1MoOofNGJrbSJqCnCG0ZkU3SmgEqj" + + "ljqxILxoC0NXXqMYPKZsTNGgseiQX1Um+tDnWCzEFM5KYaQwiK2hebBFtFvWbIKl" + + "A0gySQIKEVUFY1qkKQisEBDEYcpVOMqLjVHCwFV4coAKcGYVaniPIi0IDFCEO6py" + + "iK3Sb5QtwUTkeVRqSZvgtiPRiC9YmOGphARNmQ6kLF5Mm9RN5UknKirNlCkLBMDw" + + "LZGwouEWmYel0VvPJk0f9vqDgB1OMRmKZKIzWahOGd6NWRFAnCIXEL6B0Uc2fl5P" + + "sIeQC1FobsyuXXTiCpCs4yTW8WkdGVi02BNTSDmtnKPWeq9Y4twF4gEpDgiKRGKA" + + "rATvQoMREzE7FMRAK9ixd+aTuQoIDMYQZSoQTcKEAaDgwLsSRHUTmeBlwAjqJW12" + + "haMGnPdB7Rko8t7UYLQRAzDoHldEqn4zfIlR+ahTFDj40bkEs7N9ubb1r5Pkz4P7" + + "KmacMbzsQ60kjr28eWZT5fOlM3PVqKOMRxDR3mUfp54ZLqzcSJorg+9hoxMGzVzk" + + "E32DW2JtbU2qrPLpN5Xpxamjzu8wb1lW8jakUx6dIsLnCxQwpEzLzYbSCTWTEZrw" + + "p0sG2G5EvMnZyhFFF5tTkG1AZohFJveaYcvskKd5SozIJ5nClUEHKNtLZSLNdA29" + + "uDYo7sXxjC44bazLkkiHu8qrYzJnnJ2oQ08SqTZVlzXJN05fOLkVt9y4SAdhsUds" + + "ETItUioA4xSCJRd2ihTicgxYcOnBhN2OXCLbNOTBhkqTgh2g0U4XAdMYmaJDRnHR" + + "R4Lu3sBvFYojVUFkFCHnDpF0yh0wkgezuLUwW6maOnVNAne9DRbH+AAHETar2+Ft" + + "41Wuaum2jm5bd3WKQkCQUMg9FB/ynAQTMVeIB8oh6CKP0EAQxoFOUgEEvm7+N6n5" + + "WSrmuWdsdiR+nu8pv3szvUcbeXbM8Y2rYHrC4l+zyLjDfmIMYVsENPkK9m6v+lyT" + + "5D1f3aEZuONmS117lX6NWkjPZo21sYFwu55fns3WZHrU9bIXYmXLdyesJJhtZsyP" + + "8XuYeY2qPLzk8i2eMXprLlTUee8pZwCQX5F0LaW8MCu2YWI+FoVCAHBD2BOl9jQc" + + "oGoiISmkexUTRuFCkqlW4ITOGyomsKYHBjZrY5wncn7k8ejM3ET0XYlJU8VglCrh" + + "D1mEVbUgnLS6ENcMUAAwOwooznxlE7lPuAKOBPjKFlnYC6ADqLSrEfFWgZgi07lQ" + + "JqzHsmsUg1ZBbG7lW9a5qOWxHURNRDgomOIhVc+e4RuBqAVWjExp9ZXgMJ2l+KEV" + + "vOwwHQfplT6irimoKktr1mTvMn1AI6Nj8IOjnF6dHXSm3bQx3SNAEqFigcKwa6F/" + + "BubLQ9vcq85KsS6AydGpaE6qtgkARpz1BKuNSoGBOgBQ5A1kBa73YHOdtULNUiHq" + + "pDygDESZngsBXWfdQdUGGBnhtbsFzJEXO68eFC4N2M3gCnwhLjo2sgkKuQ/2GLWH" + + "g0I67776B8O/3enHovnD5QgD5SX19KJhml4fQjZ7+0Q5JZrA6YidgWYyY4jl8xSV" + + "sK0myHtg0AKidGTG7nAv1K6y5UVikEpJJeVcrzdb0hpFKVRzLlSn17KMaMkjCTLM" + + "QQ0FPTr0SQkXhEVoyWhvoQ9yPsIB3yDPeHXPwPw9rkIoDOGz49jxbEtALl682Rhs" + + "0JwxZeyKgGTMoB+YAhZz8Qa9iOMdcWRB55QGYQwryLwiXDkQLgYR9ATDOHVU8lId" + + "eOvOCO8PhtQKPJPaSS5gH9u2h8QPjqFhzWX1iUDkBGGRdQFORGvidcljOQQDzVBl" + + "TGG2UR07istKQkPDezFCw0PURkJVk1fFtUDEY3CtDUhqIFYmbk+TNC9bRLgC1B2Q" + + "hmoGNNdEXHTlVNGEVIJL1zKJJcvOiDo0nuITwMO7aogoMQulp1Uzxq+a5SU07uZm" + + "vE1CJnZZ70OyN16aWcbe7CfhB0W5dv9C6SR3sHAFMHzkGZVhljT9BtpAZFGb0IBh" + + "iANn4yVtUWWNjZlODZOyQgvvs4J4XQtR3HQo1zIKaCGoA3MHDeDBQRyGSIusq+Iu" + + "UOnPeNgBZsMVdUK/MA7M74eXN+cCMybrgKkJpI2AViGsH9t9NE2mTXEAH2u1lnrn" + + "3EhxUTGqz2uqtiqAhUVEQ7IFAI05ncwTfKHWxRzwOqtWiKznM7zWPbVzw4j5iIaD" + + "SHW84UBRM2Z3vmt3R7bnF9KAsRXK5MOIWdxy1IhO4yIpyYRjiTl6klPndDcCERED" + + "fIAlT9GeQO/FHYQ4IvbAcQGRxYyPYeZewWBoEX3dzOxpl0F2A6Xk4RptVObwVYvR" + + "JgUdJSoUBw0WAB93YAWGu4uiaiu2D0oQ6CQqYz2svjWxM5GLngT4hPu9PIny6IsR" + + "ZwrtKctQEYHDXdoRqg5oQ2uSsX4bCJ3NGGNxFpY9K9jfyTMPt60P9tHlUE941bvY" + + "0CWQSCsNUdyq41StOyY05v6ryYNfhWLruNAJjmG6yfUmfUshkQw5BAYqlskE4XZZ" + + "0rCcTJIRvQcxBsbodFNqdCpMhmSYhrWBxkg7XIf371jehCbUwexm4dGgVDsU5gmy" + + "ARYrMvjRHnRAjrEi0GYc5Y6OiwRdCNAUhDcJxjcBNIBhrUp2G6ndXbO7n1V1kivl" + + "8XxGjFDj0HsLjFztVYhL2gQARiRjzTgeTHDnuVV3Z6EWdEVx3o6ECjQ5rCJk6KO7" + + "JyyngW7FaBI8Q0m90Hkz6/HSOXw7wPcGEkM3MXsytQGxEqIOeR5s569+9oW4M1qt" + + "CS6KKEewSrVVQ9Z2x1nmgZsV5A2G0sh3RXUp64xy5NrrMXvw/jH9rrG9Vbajixah" + + "aXPO4PyEx5aentlmgg3UzPNcyQmn8jm7WpaxrIJeGcWmiyb2JVHMgUcgNYWQZ8qR" + + "l9nHMTRw3MikGYWca2t3QhhaYddzCOLk1SxmG3vec1U7jhzaLKrbNpl7cveuJ4GT" + + "VKmHNOGIKDJJCa1hZpVTd9ddzdqXynyK3LQF/1fvHvFwDEEAgG7s21nIU4+UAFqO" + + "BOzZXxvafGAJlsTLa0vUiRYNbsqb6jMCVwky24SylLvbtzhy4U047dzRIGiqxGqI" + + "kIjQID2qNEqudsyoALL7RxclL04W5tQJ5QDpK7RHXccMSIKzBREj6ROmSpdaVrt4" + + "adqfw1EQX0QzEHsCa660tktLxhOLIkn2OyUnq6l1++dxH9/n3L2c8+25+V4ffTlL" + + "WbIZ6mIoWFkymTGcEwjhh9wUdmPPecx/I04eIAX8Pfv3s8Jw7Rz+F57P356BfL1E" + + "2R485lDJBs/Jx45HbNb+1znkLrlQVg2n3Z3ePSJuR7bhMxd8mt5Ml7Cna2v47Av2" + + "ShobDchLus/dr8YRijOCfI/aoS1CEk62/SwaX0d+zqSS4TLcKBNHf3WDoO6NgvqD" + + "AcAR82hL32rdu4FRZaPc4BSzInYiK90PsiBLMdwBZzGeZDD4g5u3gUBylQUbarAR" + + "BUBIVnQqbgplEWh9veEZod7p4BlUkk5VEijGEoh0dAiX2FHNFOZcC5CaW4XLEDTI" + + "SgogmLJAKIqAY78+xmDgxem8eRwYA+e+7Gs7BLa59uFG8ZoVeVgy9USRkUkhykQ2" + + "gdhQBuNLAzEGQWz6uWiSqgkgPFhL1X2+0eYLcIcj3iZyxIJ5vmkDHss1UAY9Kwmu" + + "cUvi7vEKuyu0GwhCTA/yoyJyKgfHT7x1mgrpxkN4KkOQXU5C2Mg4GpNJatXYSKiD" + + "qMyBxJCb3pESGxB3ecBzpYGNW/OquelOkMMQhLMNvp2CszyQXClDLJFNasPABkrG" + + "Mqh3NC4P2iBrGm2BOkclnvhVhaRISz3tcWC4e3pxcma792AaxCl7oESlxfjoIKJ7" + + "a2FiDuAweHtnbwXS5c7GQzEPRFNwEFkCQFcwLhdUKEAz2x8RGVU4dMOHfKVIFIhm" + + "2iWtGuVMhENpjLWFciSZlotHBr+3aNL0JXa8XgqPAEd6EVpKnkMUG11O6XJWr5Yd" + + "e1Z9xlu5eR7mJ0wHvDupi0w9qHg0QgciAVh2IX6IXeOlrntOQTFZdBawzrREld3j" + + "PlFqXVGJkUYTNlohLiPDOszjjML0boQtWicWm1LQfEJgpwVZEwVAf1rpwKDiWeW2" + + "T44FofGx9X7FflnTv57B7RWfe+Ko/xh7BrfbW16MdhYNV5PvlOkBqBZnJhkCwWXb" + + "ALoENInGVVyEpJHrMH1FM5yhFxZi6xvmHQaSOdy8vvLlDQ0cip0Q10A0glmjphjg" + + "AtXhh5sC2DuE7wOi1ogHvNgoaKThOzB1lxriiGCeshTQvqL89HPQ+io6J1Omxss5" + + "Zv6kfi67wFWe2dNZFCyzJZwresuVNd9sV2RTnE5N7GjnjtGhDOLCGejhEM4VqEAY" + + "I4iKBkRFL4BZuzJlfc28UAYvBA0puE6ZecsRdO8V2w3M1t4YGKaBMQ9gzlCEQ22W" + + "BSqbwKaRdjkQHC4ixmWzxGIaJQxyRAxHr6FlXRHCtOM7Ur2KSG17m5xIKQuaUIjp" + + "KPU4oul3DGBPUe9XNE5SjJ7usYsvJroDQcDTaLFrKnCLS1aqHqo1vSGEySRhymq1" + + "0Ub2JdLjui5Cg0OgAyFwRzuTtrLIETnek84awMtCp9ESClI6GC70L6VcHG5I5VRM" + + "DxkDYaht0wnKaDRTpUruQQOhrJt5eU9zwnDZsQC8XLboLBCToaxiPIoixht299g1" + + "eAN4RdbBM3PFsKrg6ERTws9wPEE53AHu9HnSjwnUOBSNrBA70oCmilLYPe+DGDgh" + + "6AG94FT/EZfpoKj3EISVg8QpAngqM8vmA3SBJCvRSw6yhCJNdyVUolCjZPDeXsG9" + + "6bxkCEDL4kgQb0NHSghSvjbgTCRImOgQX9g5YQnK1JnCHQir06levMFKVYkHy0hY" + + "Iko0oj33Fl52C2vKsBIXYs0AwtC0BAVsqkEI2A51DCQ4czmzpfPFmm+b8ANnSoK6" + + "NuBO5JsE9wB54ZFkSd6awB68gOzx6BZkU0W41kPJp0tdlQoNWMl5ouXnVwAAOBQV" + + "QtmwACYSMN8JJSXDEpDDXCxMzIoc1vtUCyI83wsQowQmOdEQeu+6wUTUVTUZ6V0G" + + "BjiUxQLwwVYDEAdoXZoZo9PK2kLxhW04FenMCowg8QhwJC6ISvJoZdAMI4RxmXl9" + + "WGpq1m5QDogASIegEgDIpUXcDP6wOlBb2oB2J7FIYiZ3rGZXNIJf2atRcQbYVDkx" + + "Cz1D0GsdMvIO8NzFYSwtpbyZ1nGAWozaQYNERCAeNIRK/KCxiAvTnMSeKBcSoITt" + + "OIamG40xIsICd7QGYq7g5yMZSfYIBjSC8cIthVOmEmzl5cjRRQSFEKnIqSKUG2y0" + + "d4pDaUQkJ5CMiAKrdvrMLFEIFbQrfWW0hD7GB2FrFcwCpSROwIDjxYYPX3mjKzEA" + + "oiIESUYpR3ygcvabgvYb5JsUBDar6xA08yYdnJ3dmc8KkH6un9F+sESctLBFkQGm" + + "Ta0bPig+sM/K4rcNlicUhXGvkeO2yqSZ5oKmK7mzQnIIpTd6txohrPWxC+w7O7Xd" + + "9LQtO6uqZLhzsHZpRcxYOi1CFignFLhwDuxorIb1rsUMRBHkUkH9+wAqL2aiyPoA" + + "lLwUclJO0yK/pNNLRBkAgxgRJDowL+MDbn7aFmDs3Zum7TMmpl6eNnnKXjW+cIZL" + + "KTUDBhEK8ciqkQeV7o9nO+RdjYhyConjMQRTBWmeLu3GkKYbSDZ+NFythpRclB0u" + + "+MM9hIPy379/P5JvRp9K7Hh8rACxIThkR9bC/mjT79r7kMrZfL3DsQq9dPzd80jy" + + "omUQ0MGQccce3Fj7MWzP6VNxLUm/pBuxmmyioIE45y9suzCqg25nIpkvY49evNI1" + + "vdkD9EHHY32D6/Wt95wXiY14QGHv6Tupr4QlovqZsUxN/gppAOiLCJKKRQoB3Tq7" + + "wOD2KVRzt/RlCRyIOQHSOSr3uh4krxkmwT/BsrQ79YvUxmCBsaLPe3BE9rd44cRs" + + "EtHttA6UiBxgHNHMBs2t3WoqicOUCJ/pdOhWwXx0xzvjx3O0KVN84or1DOx3VbmY" + + "XBKjiLHHQ6cosigwdb8KKicNL3O90EPY3XkwoBs5FPf48Tw4m8Z4osEyHXmsb2fA" + + "Ok4HFRdQRcU7OGXaHlQhmiCfcEzj2hQNDNA6MRu4t68O2Z1CjKZpojvIZ6gSyZPH" + + "rL9rdnsgo9LEDXNXd1XbuepmStaOYiD4/r5zmElX0N6F0Tz3VCoRv4sIsFhYUIgI" + + "numbH4pN2G+IcL7ABCaNu1mNj6QkUIMAhtoR0MMPiEUwHvdwMF50hG8QYCTnhfkt" + + "UMX5FQVzDOdATVLQbTBOoetSGcCjNrjgN51GgITFdoNWnL64lJHbNklnJKcjAsED" + + "6LlEuu3zlPY6SEcibIy1pLUAd0IHMRZuIwhRlzAXsU1wRK4F5NYIkTsbgaGKAOrk" + + "3mDdrs9oHE5vbz3eO7IwqJxcJxDru7DPr5kZnfTpXLnLVEx7eQEex5Vc10EW/bNS" + + "/UN3fOWkQhgOwHG8e4Yi8HiGe47HhLNWwnMlMsrBHoa5VyAyXB8ny2xOvMcOHDgH" + + "b3EqkrzSChHUyZmLI+6hu7wISKUqFFKTFWDllLromzIiucDwBOQQ1kp6KGChwrGN" + + "IdiidKkg6IolNojcrO0BeJ7r7kxA8TUb1OsJ0DwXlDQCiVkWTKjwgEQoLqhDMXRo" + + "Qo9pGorE3XPYHlVcm/Fl0ZUNWuXAbPgxVowsObJtykwDZmd3Rs9kF7ovtgP9gQ+4" + + "ImoCUYDVbTqWeNIfHhQ3fcGSykKPKGvzG0gw0ZETg97odgi+CtWJvpYu2qwoTAIs" + + "E9R6CGlAcEl9tTTwETIhk6KNV2KAPhQLimtCFryG/Hiw3nYgO3u3TfEJHQuFVBHi" + + "QGsiLqgzs4bdm1MO8CUwBqvDVp0jQlTrbg64FHW97NcVIgioHQCAjzim4h2byc6c" + + "ANEWA7Wm3xWoYIRbEHeZqnzzDMAxmjmtCjoyJRko4E6qJSoabUiR5UHY4rwkhjGi" + + "57nGCJQGyYa6EIE1ZkbQuFKKxvM0KGlAUTD2PCxzTTr3sa2oAwP2Ie5M1JRb4eh8" + + "NazCTDn7w1nJjXI8EDCKsUADgQVYSIv0oS9b+UA6gPIs1SOiIhCIbAeri0sZgp2q" + + "Cjt1qVoBinB93WUFd3i+GNTr0BMoqCtDIo66aNKIkZtiCtBFYTxRAkbRGHW4E2Qa" + + "wGELRMBSlDORfaNHjJo8HetTIRdgB0R/fXAbO2dWJb6DfUEsipYiw5A0GnF8Ezhv" + + "GlTxeCaEA4SjJdyifLMm9GUIqQiABhBNrSrnBJZwcLnsUPG8AVmRARIaJRIAl2Aq" + + "vN8GsE1zgnAAG4OQm/dxkQHKoewTW3RsFeU7RIFDvSeKq6tmLIwK8gvYW2oipkRT" + + "wRjRc2uNOhMZYE5yw8o4PRldld0CRW1Do6zyeWGLAfbpCqPTGDSqcoJXE1eKBT20" + + "VES/Gir1g0EQCpg7m5ZtoK5GATGOZsXKcwCUdiYw78huOate6CDObwFxCKBgXHBB" + + "V6vNFaO1koc5AG7nTRtcl9SatzUT+2esG3qOOQchoqjI0MZiYEGiTyVZp67hPaez" + + "0Y0m6xKBzy6R5ZAO9vJiMqshjhrIky5HVSaeZ5qEyNVLWOJtWG+4jGMGDZuXubu+" + + "1BVxAySGWyePnaGc7uXgXUFUo7J3BHWdzfN0ndx97DRHhMuD3FIbtcmDu9FIUiHM" + + "wvJzV1rl7V3DAElvIjuzuAN5aVFegjAg8oRCh3gtOg4EUlSNQ+g+YCsNL0DFoWiB" + + "8GhSYOOE2b5zZHnFEUAwcmIWCMHBxMSoJhWMWrtE4EJmAmGLhxoTvSHCijrgpjFw" + + "YaJ00WnSJr+RmC5jFqtEbUiI3kQFaXgg7vKLYF/fBgwaV+EnRk9XQKQPOgkBdnA8" + + "kKDUtNQ28kWcA2LCiCujWK5nSsg+u2au4siUCIIuFgTFpAqiDAnZW7L63Tx5sg/t" + + "IR5eMo5HINaaOXDMrHyG8ytg+NvLtlHBkBo9kRnrKYt8/qyVqWjj5VEqVy3GpUqV" + + "hixKBqJGzkfhHgoFl/X1yrlEscB5vLEAKPAYyGQRirBKEZm6RZfA9cJGIMRHO5ca" + + "CEW/DnIynaC2XohJQkB3yhFrMFq3qxHJ4+QOtEUb2wG1dJBDDTr2sZrvJ4RcRMbT" + + "qH2Jdooaxt0NjDiScucKju2YzYaBBzvUkkz7Rs5QxX2gwjkdYD4UtQubOAigAFmX" + + "wNXZ4di59KNNkgtapzDO5Ze1RNDg3lGlzmLiBgSsl48e7xxrPEEVA8DigDOnCoWC" + + "NyRTfSavpnxLQ91Rqpqq7DJKoyD2FuCLkgrmASASJuqhEdivR0jzeV9CZNSuy7ox" + + "U34bo3ZBM43NBAmhDigDK71FQEKZjWNaenQQjAhUwtFmR3diUG9KvqSEILrtcrnK" + + "JYMYsRyZAMUMhxGC3SmHeUddC8aQDaajNAGHbXfMJnKQ3Io5u809jIeOAiCmGwEc" + + "SGxFf2Mh3Ck7Q8NmAQs8MQPGwLfoDFgfOCTl3U4o3sLxM3kkQktElpUOIQi8KGes" + + "JJoQV1lFdBdVKBU8i65cXjg3ziOG1RVyGUA5EA1Bz2PdlZvXiVd3sCFzpi7ZkuuA" + + "okzCH5e60sadzfeQCtFe9t3jHrFGwPRHJzHlWiIzEmgstR6IY+MDjh98XwynDQJ9" + + "BcV2odeecqlvFnFC/t9u3NHjnIqGa7bYikVnM+yf5vO/or7fvUJSIr379aG/2n64" + + "/p2BO0/o9sxrOt3vIpd9x5yvc+etFPveVHuePsUB3DIaidl4CxRx010k46whEN0I" + + "g9O0ug506JYDlFzQbuZEuMBAWvO6IBV8LQl756E4B76UHCsGLzEOHBSd+XvXk9WI" + + "YMbfg56ndwHELY0vRDPXRQ99d6bL5OdJIUUzbJDqWMfi11tQANmXKblIsgFamLRx" + + "GwxzOeJQdSQi75cWKugYgDTZ3sYwfDRyoBTFJzhNZdKia3kOBcotQFEQCbS2nCSC" + + "TtEiEuncq5ywL4jCuAjum3CYQzZnvAElVp2RRCOSGjCgOCgk5JdEY3YqtbGzSJKS" + + "UdKYzo16eoPENGLo0phETPJZ6OIkAK9m+kPCOQTXKwGmFeO3Qo9mYJjmt47wpZ4n" + + "OUCpkBXxs5+EADfPu0KwMIEgyIE6Rn15vJ9n2j32MTvEFNRG+O5FKG2lrAqyh+Tf" + + "Rzh4eWFJaDwsQTEaSEdaoYgZ1LlWfjUAeC8q2dWnJ0LQ8IrFg6vYcrdprGOfYLx4" + + "1uAB00NBrexzAOhxEV0hJgfdnNpAR2yetGXXTyUK7POeMFSwUcyK0k54TYZ3BFZc" + + "82vsHiaF0rspFEpTTqjrGMohOJwo131kTcrGNoxl7VJWqRTYNtAAJC7V+xyyGxzg" + + "D6IYN9WtIiQNBELyUK0RY7CBDsyDhV4eNdSOX7wMOkXgGQkRysCNmAEPpdYUaOma" + + "XGtvRVaKBTpnHMGXsHRzNvcHtrkV4qMS3LQYC7AFDRgeIQXw4+CQaigKJZLolFEe" + + "ynETG9VkDEWb3PCLQWZvtb1uyQ9OCb2ljqdYeYVQUVrlhSmZCCLoCzeq3qihdKlC" + + "FCVu9GdtanaDaeoee8Gh0XfV746AG0mFR3grOkNaEV4oAxcwugi+5mLavDgNyeab" + + "aPNUAdaRx6GueEE8UgBraaEPEBA90Hd0IoiYKzzLeyC+QP86S24oNGgPN7VEZLkc" + + "3KKB9yaO3suM7dsqIyXBAyaPJIVawzuyNy8Uis1TN6MwDW+Sc8Jp63uyww2NEo+W" + + "pXWbpGdzmc2qkqcY5CJNMqipmJnZ7lPXMBYk5A0CO8LEGgRCLCyFEGqDni6GFwh4" + + "ISrK96I0lzDiiuVYcpktYea5V0fSBQQ4HLSCYxVJEIpIEG1ivgPWGQ9zRCT5pzks" + + "lUdNyhMqyFLVbXZ+dbaAL5MolnGQ0f2Y0lbErTW9N9zvnf1PL7QhIQj5Qqg9+9Ze" + + "cP2k9FIfAnPPeCQEemCDu+PpovnNLGt2xn12fm+7k++eYUe5zI3I85qKYoJjmjnl" + + "nmGtQxhZ8OrjWLs29chu705lyXsj00pO0r01isVaNX6Hs8cRtAzPRBUpl8Xo2aUU" + + "RMFSH1bMAjgAzlpfCL5AHePjDzgQW5sEzApAHGDajlxaEJMRENKpBhNAm92ON0Jo" + + "cKOslyv1CmpWvaQTDp2e7sgwMWOxFETVedrRILOecthi4+kHbXO7UCGYShLGHMPL" + + "BFyJnklnbddyTMMgm68FBsVzHACN16/QBHAADr0hyZ57ivEsZjdscOB4MukOoq75" + + "3Sm6oznxvBWSoYDs0mM85hVF3AUJAQhIC+IAnAQ0nYeBojTtDDu9fb2ZgfOvvEtI" + + "Ir4U3SSAbviqYgJSp4BnTGwbatDG9A3mGF9hEO+hcZwvmsmKw4IUUYSm04b969eJ" + + "yhd9UFNe3iSa87znSZ8uMCA9unXVOthwgCtrI694ULz3RAeRPJ0dGGH4cQq8+E1k" + + "N2XKOIV8b7t0k3pInQ2SYhUaCSxLkRMIbumyj4sTVz8/OCjnFqV6iuYCrEQETZhg" + + "aTaO1M91eVU+0dN5lIKE0hY+6ZhdH8xPatSu9IGjiSBRxdlYhnVgx3DM3OmAAPUh" + + "oivOGZEA50UKDKlBGKmuKZHM7ZnaIrey9kZzbWmTBux5hLriaXv3sCjh3RSQN2Km" + + "seQirWUXffY2PUwR4ix73JkV2Xnrhe5wc7ATvBMNCGsQ9s1jt3XLtQAW0gIAsK7i" + + "GYMN4XZoBFGRARR6qCjNIi9RgC+TuutUGw5urUrW9IBs3WmZh5j0JAQtReBHKKCw" + + "Ao1BYPjdMlMyTuA3z3s5HrzxCD7DNUpI9NKK1QCbU3u6DYiKaA7sOUSYFvgSL2GV" + + "56raInCNge3z1vokDQ4oBA7DVZChDpWQ6HOcrY+5Qi5tmkDUUFPEQNwVKiIBqChg" + + "igm4JIiXEAJEBKiKBIihiUjIdguH3TxtEV8CLnCZZJXuZrns5yGzNcQqb5nRD8Kf" + + "Ejj1uLimHfFsXzlUZzvk7zxYPeGzkRdgYzYoe7Nc34mq1NfS0+Tpc572vBToIi+h" + + "NC8Ksk0wShGEgp3jOt0s2159erxfPx1eTb02DQXSuDB5AkTVTpTmMjNgcOdrKEzr" + + "tc4aYgDJqgdKhmhE3HZulPmAHB7632oFlcTlmCvKgosDR7ft7TOgZfTYJwR7AXuW" + + "/S8+gIFeKNjkv3u7oLzAyBFiIY4bJOh4OuYdqgOIWvESJAdRUwkRH0TBzeSHfdN6" + + "Bz4E9oSSCWPhUXvDkFmbZ2uSLokHIEKenMqeTFXgg3poKBEk9zF2SbQhJap4uGJJ" + + "FC6V1rXoCFhRw7YcnMjkezOEULe98ME6Ds0IYzERWbF33DHNcyL7qBnaeKKU8Wx9" + + "AYMaYwHMmO44OFPK1nebx24PdpQEPFOIOCGGRgnfbPFFecB7CSMybA7NNoCJdWkq" + + "A6uxgQHTSlzjN02jfYhsKEJKfK3grm8IX6/ZCr04RBTyJ2sbuCdybNeEICJ26MbJ" + + "jeDS6wgqPaR9ormfdmFDLWdBF0bbY2212EiKqJfXchQkdNNXrLktUifqXfCq84+8" + + "Z6VhYN5i5hktLGeDvDyUvWWAs27y4SHHMOtg0Rag4RHHJZJzJpVzqEypuBMu2xKI" + + "MQEgIgDMNB440aFxBiGgVIhdjaNkyK8RRKsepNlmwLGE3pI5dmBEqgxMdV0KaHO8" + + "HhyQ2xG2KGDGNoGzBt7biE+kQ6Bod7WXByC2xtI4zTaLsEoGd3XlmZdylWF1alnb" + + "M69mJMgnkxqru4Oogy+Ri7zgqVzMxct3GGZgXGSdkzJjhyAuE2PZ723DJwTyMnjh" + + "l3tHY5VDpUieCoJmSC8uhRWOsIvHrs3IcXRWXW5dAv7/778fUJpA9gUVtiDse9fX" + + "eLqjFjg9tC9YHmeTlFWicKAUpOimCqgEtGlSNGcpe3u66YHC5aNSJLww2kUhcBCo" + + "sQJBzkAYmK7l1EZTiK2JEzDnWILQWZzI5NHO5yHsQScKeLA3Y1UxANcWcBcAXTZC" + + "nG3WEshvETCEE/bPauJ2LcYYpkGUUtAj4AMoK/tv6dyS4In1VQtIbiS0kHqwagwE" + + "s2PM5itnuLiqWW680Rhkknpn2RxZA/NquFxL9qJ+MWTj/aqbZM1Eg28nmVVm5HKs" + + "lPLjlU2yZl+lLy2b+bKSNUYSElldBP7yb+gMMPeIR9GJowRgkgRoYVdqHQlwIDLQ" + + "aiI6H1XmnDYFAee304yulhRgMIl8rODvjPsYDh4FRB4lS0XTd85zYMBdO9uA1XQj" + + "EQiIrzFbmDjy+83gvNdxScSEU2bnSmgAjjhZ0eHKQtVyg3vI5fSCEKUQLGWCcN64" + + "SoBE1gka0aWw7IlYUoJeMdqQ5ytWEITjsqzKm8ZQESwE6E2CN4IIUSEnUYdM0vGl" + + "bHppfLXOIXBTSfWIgFSl6IChy+B0e4/JZIPYtHBc8xqqNyEaYZAWKNvfjpvJ6pXN" + + "iRCGxlbePrTJreU3HXYA2d8CBSRKa51BpHeF0vGi5yH3vMvA8hjcyHuijgTurUuj" + + "QcspGgZqbDJsCwLljxYqwh0UedgzggA1oQPI1qSzDKyyTLBusjazKdKbN8Mpiiht" + + "tahHCFFJFECD5lOaLBoYNnSA5Vo0uVRGun3s3jbMCD8MAOHpiyBtrvGjhr1I4Kam" + + "hC90hDDgrxsCgbMgmSDrjyPJSVi0W46roi+Blde3oaM85BCOMlkvxXOBKzLEV9tx" + + "jdKcCx5V102vHRvAEBovGic6QBeiErtETJWKgpIgxvYmMdZt+YQ8c1CsakICg2WZ" + + "YJ1wKg5NIYcsHI7TKYIG9UiK5Dh3nMiYQyjsFTApEA2cmsjhUIqrYHeoS28gi1UT" + + "O+eZXGRAHUG1Gwk33qXWInhbyo5dSTqBDuQtgRSK2UpGW9OB04oooTkj1I1XpEzE" + + "sEzSF8gCdoVyiYDkYCLfSn0SyX2hCQQsiaxSyGKpCEVn+T+7ACroi7X8aJopBWVZ" + + "ZWHIQaTx4SNUeLDFSxevebd+cHKoaR+Uldj4hZiyxAxiEJPs55pQEVzsqkE5E3EK" + + "C8Zrl12Z6ZyL3XJIIiYtC1Axc5KDSj612cHXeoDiFrcpuKKB6LCLGCsgEWAcjIYi" + + "7hqF7Haj4908uyiAKrcawQQ5bsgLte4FvgR3kPuHtlEgneUBi6RqG4DiDmJiBIgS" + + "VKzW6RQTsDZDRB7vFB/Npbn3thjxnOfz03l8o4iPr5vcTXayIrevu4elRUVaMYKB" + + "TVWh4hpU3OBfMUdpqaMvN5RfQRHEA5SRsCqgNvSaSWAjxg2Sce8tmpLwQTzaEJKY" + + "a7vw4DMq4BBwDCYqTySZ5Y4qUEBqrTyjRBdDSeJIR3x93G24dW0Fsfb52b53LqcB" + + "LxkrVu+jOgAOVeWKSAPYajZnWDo8DQrwVXMRLreCHM8HdKQ7MnILkIj3MoONh0TW" + + "CXGY8bOCBgAXDflHcvJbxkD4icpcbMiA0ObDPeZMm9qh4TsxeYSrNdsERNogpnNA" + + "iWcLBMk3AFNaaFs84CFDeDFXxodhl7a9MyVyMFFD0AIGiNGCvoSCLqpw0errcmtJ" + + "ZMaVMLAkEC6A0HNHB9bcXzSDliqUfebISAiIRkyhvuGM41wC0GZ9e14N0k1dvH2j" + + "IIzL0HDgOgo2Teq2QOrLViXLanCQRVQkcYimjkTcFagkgFwMQzjIhkESKoRYDARO" + + "OUM3MEMWezt6GgSuFhS2HQXOveJgcUGzsH1FZhnVaE8D1kRDjrF+riAwE0VbuVvu" + + "Wx0Vo0Ivo3snYbRflxgcfJwR3m0ICx85dsSDvT3cZ29Q4CWGBQLggyCKEiARitqr" + + "sNm0fTrW3Krxa102dakYpVhqwhVCrC2SGOlkRk1UlqBaSVYVJYN7ERi1FAbW+G3z" + + "51re5VjVbm5W5UlbmrUmM9t/6/T6vv9Po7vhq+xJDxqrZJCSN4A9ebXxyczXxmoN" + + "33VoVPS3BLDLLHbi5spPNZK0uCZvZgZzc23MBvtLdad1ruTZJGVJwaelJw113fR8" + + "rnExqR0PrSFjAyjjVUETBCGwkwwK3s287kNjE+yu0Hbm242i5VRLlk0STTSgxaFK" + + "RQ77zTcyWsiGy8yIrLiHHJjtG1A2Yw3W9UlzdFd2HcNCqkQgyani4Bu3NroVFnYL" + + "2HzDRFdvTmig2HcOnFxATrA0TnGma3YZz0ymbsQAYJGBFbqwZSEku3x21FBfCArF" + + "0wi6MyRrQQhzxXZCortLApgcocDruDxkuASSjkkCRHHVa1oVlDu7SymYTanF4+3W" + + "eROwxPvSBh9NNJ8ik1JAnwJivP2b/k6eXnnoQc+e3REtcmUhKCgg9oIgj3cO94cZ" + + "1/yZZPYXmLsEVzL9wyayYqdoLf7u7cMaiHlnOXVcjK1tFvlVLZVUn6CtS/Dc2MGy" + + "jQgfhC2Kdjr3P4oF82DpTA7dJI8fmoIQcC1skeRzKgLQfdKJKWsxDeDRAOkVD1Uj" + + "6REe5pkkFtcBVDyBmsYcJiDPKL4QYIAKg3pFBYsEheQysfqhKb7Z5Wjm10jpNiZp" + + "B5IyQBQMUV05k5WF025JblIlxOjYPTSQS14ht99a4g4RAIMEXBQ9VYdUOnAHboCb" + + "AM8xBqUidwUIqCaNuDndlLcheCQRzyDZsza6jpcC8J5t93uI52DOCUmxyBWG6xjU" + + "DfvcQN2R3loD2RQpUCyjb0Nnj8jM44gOI4HkYOhJNFBUaBwiiugHBtgmVWWcPJ2v" + + "AGlYg8pB1knDeEQyYzoFW+nZieSuAOXHdpQnYHIIvsnV62gW62oGOQSq0ZHQmkz6" + + "ve09eR6+As6PaDEAPBAjCRxHiizSKSWE3lI8fDOCDmGnmVpNbi8eUVoBcnjVYXJH" + + "Wy5Y+Ig8gsiDUDTA6xDbTXjDHGKyNg20+8AoKRpUzjVgeIneyymHNIhlOlRveBNb" + + "AyNu+YZy5q7JQKKSSPDgYkgOZ54N9vTDVhqc6UhuwvCADsV5z0KRpEITXj4+mgml" + + "oIZg4a71Zlm7m0gkdp4U3zAnK2iHrqjsxi8S8sDdGDo9ucdGhjq81Jfa1MiJSKcB" + + "A701FV6aw8Hp7V9EURNiZNADwG3dhrhp2xsMQdoNaPWpg17FE8O8dR1VHRzpUzs4" + + "oW8uITBTDYPLynlwZDIItG+CIpXe2AKuCI7Qs1rnC94AEyGbMuhIPF1HgmbONCmS" + + "5k7bSMjXhXQp1OCjmkAGTvLOmI0HOAt3YzBQRFgqFp2bepbOC2EIwJLOpBSCVEHI" + + "kdNxHOkAQs0VIpgJl4XMHMjEgid0t3FO8MJhYYXY8sERIghdxq3vQKeC72BkdCeG" + + "xRxAiGkDGK5LYsCK3AWW+AM5VQaWqrkJ3NiK8HR0Oyaird7M0013PrNY4oA67ZPe" + + "zuDTrV0oZMsRpR7ZipzQ1jzg4Ut53oN2DS2qHRF3Qms17VFoJ5zQGLHnTQ1WhcBQ" + + "uEUTQhQjEQUHI85hT5R2UYC3twsue/zOINAzYK9Mg24cwzR4rXfuB43f5g0wg+ma" + + "n54RRErdutOia0EPZPBoCriZ3WIjYiAiY9ycBy8PvV0fdNCtr1kSkUTFpWjZQ33A" + + "Gh0a7ep6g4nkWoASDIDjZq/BgHfve9jgEEhzWCeQR7Hli6A20uwCorkhnm7lK6hw" + + "1GyiXCVzPlIK80MpCjwRAoagLZOVxmZA+eBSGhCIL9tBXabrpw47c5zKNaAKO4sL" + + "7KvUaVGgeYA4XSjsTXG+b3fBFtoGLhoKvIHohI5zzHSwDMUyPCJ8Zjolsa6FJ1An" + + "5EizYQKcpor6HHhk6GdulzXbHMekayul6RlzuOIXQHGhtCOsOrdgh5yBUI4QD6cJ" + + "CNmU1QYJoXJADgxaZvbMMEEkHSPshs7OGaJOF613Nd0CBj2PIi+PXV5W90bvAECz" + + "SV7CKiJiGUeZErQbfUGQNmjhny5vomzEBFviHjwiiJ0o1E52tFzGaXbdCZ4hwwYE" + + "QPQQkQZFRB5oqVQlVfs5E1NSQq6LJmIhqJUJBkSTmKRwxxBG4hmGYgYhOlbgcIM3" + + "Qhnd3c1BbjEYvIhbZzEQRGBE2cgI5W4RhHpgCsRsjcdWFMN0olQDA5nd4AckRPbG" + + "2+i25y8WqkxW8Wupq+jB2ymQckBbjqGGJ2AtMuBuG4BrSNp5MsuWwgXbcCXcIAxo" + + "J5BTSW05do8jzcwVXNZNxgxuimapGRGRMeE3YqpoRFQVEB1gVMQgYxo7G7bmRDES" + + "u71hcZac1QBCRIHe0LZAbAbHxDwuLIhFlGQ311uRlODv9YkCQRH+Eh/r6Q/7bT83" + + "9x/Fr+4/N+xjJ/ef+if6dubx/+uT/af5yl/qO7x5v6rVWuWZlZjM5eZ/VustitjY" + + "3HC0dHExsx/qOenTOnMdJLi6X+gqTDD7MX/BpCpmFwf/C6fg79fommh7CkD5icKI" + + "rVSTX/Uh8fGFGKs+lPgrQH+bz8pu235HwdPyPCs0aP60bPSYwmirZ/oP34xfQ1wP" + + "pnDAX5KPS23/G6nZ/TKCJiCNS5oIRTN0GCKEmhG9kYgIrr/UH+fx/tEuBL+6UPJP" + + "b3bTrJphJ0Vu8PmOnIeyvm4J8dKtpVV7Nxk1Ldm7r2f9z6VbD/lVr/jIa0/ZP2/6" + + "fsPJ4euM7/l/w/Hbe2qPmk4Gye8+XFXSsxt8HE/hOObeMcPpNPb7slXdTm6OZ/v/" + + "5dVzU58rFtJ4e3yv9l6buQsjiD1R2Np9hTyeTt6+038W47SRy6PY06E+P3JOgWaQ" + + "hHAkkR/Xh/2ncXif2afyf4Svf5NvY3/UP3JXCqfaxkZRL/J3CPDzFxNGAzKcQTnd" + + "cHPayzzbvLxDd1UnVvMbTw9BywcPDfsc2zm/nyMfDmf932T7p87KrxgyeFftQ+tf" + + "Cfh7HZyeE2aj8Ld3bXw43xb83/u3I6WSftIeD/xbZE/8bwT5H1OjB9vDc2fr8Q+u" + + "397X9Gf+PSdnVOzpP8PP+c7z52c3SP5Gtkn9kn/w7H1cp+5o+HrPZPv7uTykTn4t" + + "qMW5ktlnN5X7r3/GJDMMmGVMJN7siu/yfnqffmvSXMu6ft6bOJlTaKqp/L3k/g2n" + + "c/7fv5SH4e7wSNdHTnGSe7brKd9m2+rfs+75c1sWpbaXqOkkpTo6LvZVDoKaaPJd" + + "rf6/wabfy//P+Ses/dNe1Wv4P05eaf0Xg/vluP7Okm/5eu4+LJMnvJ6vyfdiuNK0" + + "Wbn2ZOW7k/O5dVV1S0twqcn6SMKzp/2y3c5D8U7EssiWcxtqybtlfi2p2J1xcn7G" + + "nI/NwcrP+tfj8/scv7QZ8v3tjkfXsw7Hk28PhyNkcPY3e7To4dLZXs52SnOcp+0v" + + "BzIaa0rMZV/r4j+X7dHd5OqeK/l2Ng6ZCf3R4MsiMaozClqv621/Cfwfp/G2c4GO" + + "dLV9XSfLMq1YzWaxrDFXxLOJ3YfCa+Wpzeb8XWTm+JzP+IICf93/kNaqLaNrWSqi" + + "ttajRqjbapmqtpS2qxVk1bUlWpNqLRWpZqtJNKo1U0ttRsy20zVJqrG2wBY1sVoL" + + "FUWJs1ikLFTK0am2RVFYUrYNFpNtTCoNYjWpaFbG0TKLTDY1RrJSWwCVU1K0mkrG" + + "yUpUbZDVikMW0bZkYotZMmZGLRsY0KIViLGjRsUWxtRUzFiTQaisJEzIaWTNYIjU" + + "RhTZsyUWxsUUlY2oyRsm1G1k1MhLM2Q2gWRRMpDGE0zA0ktFBaZGyBETCCMgSEaj" + + "EWjaJKU2NqZFooxiokSIyMMUIWEaiMhQoIiiqQmIYEkRhFpEhYqSGCLFCKEMEEGT" + + "9mvzf2fuM6SFZC4Qd9fugRia8BBCIvlh/UPmUoYBieRgSMiPA/zM5kG80OwWXxVB" + + "kDKCgX+vVRm/7UQIDInnOZ/vuDq/4D8+p51Kq1Jw/kWTzvI4d9a7SyLfWstuvCsR" + + "8vO+Ve9WpNJv7s7+fuL8JV+dboUuDPzER7chJZ58smGb6bfHJ+/wytuIdr6d7a47" + + "bq+tvU9ubKTxSujpWpbkOGArKSYHFiSSfHgG2RPcG5lSlkRGbrdlTVFVeA1pC41W" + + "V8XE0QYWbMrorO7DWTBoBRpgyaqKdSFItuzQ+QpmRRpSUkgkAkgVhutQk5vCYVVC" + + "2pCBtTYcnZA1HRmQ5KEKUJCjE441UykKrp04rW12EaksMjEqCmiOKKAiIoVAjHHG" + + "4Oy2vMLFphr2skmltbAj2yHto+/C1qRSHQI0oYJy4xPAK0hBhkBkzKGIDKfqR5fu" + + "9Rb6jriPwFfrT57/BORRUS2uxaWe/23vw/VDRJUNDKbcoql9hR1STaoUKFJAhAE0" + + "AZZLjCTR5qxIgYLhyUQktqwQ0LakMUoDZaYvf1dL7/UTZGZSt/h0bF8bOrkShINm" + + "UC5JVQoULQdWFmExZOwxx6b/nrJEIzcATXe9RX4uAjQuZbT7+8dvCcTe970nE51j" + + "cmac2WktrRIBr8KKqmFiShChQWsTPnID4M0CSyZe7rltE0/bIvrM+YcPthAH85JJ" + + "219mY5mjPQZhiZDYZA1DzBlAjUcjXvLL8BABMGVQh/A/vPwUfqX/5kl6UGGJn8FC" + + "P2GG+QceVRTNvxzts75paBK7NzM7TzVVUzlIqqif8NJKRImR08cg2cHrQWxKYcNh" + + "OjnHzz+YPyaL9PWNrPR37fFaHr23fpcy+YYGWlsuQf4q7bXFjzjZ66t5DEnZsqLU" + + "ixYlKiy0ibZsjalZamaizKs1laSpmk2ratltZbWSta0bazUrFJs0ttalazaQUhKg" + + "lSUAqyQoWSKtotVYtSmoyW220arUsoo1tpLaNtMsmtaaYsVTbS2UtJgram22rCkS" + + "qQSxISyQS0FSSyM1KaS2laa0lhNFGhYWigRULZFiyykqoCxFBKRFSItCrIUWLKak" + + "ppY2WbY2tps1pm2ymqbabbLNiZojaZkrFMKZrKzaWVptZtppijZNM2SzKmmxsRab" + + "LZs2K1NVqWqEzMlJtmqVRjVNZWllSVLM0LNNZpalZokSlltLasJRUqopUpZIElIE" + + "lkqrYjVi0aSNqWmLKpslJtFRBbSbbMy1KoplRspaNlNUrNUaaak2mpVFTZVGxk2a" + + "GTSWmzaCpKbNJW2WqWqKMmNk1GkKUtk2ysrLNs2WwyrMqKpqZmmmKxtmqayKZlUk" + + "qNltKlRSm2StUtbLWxTNUqlspo1ZtltNKRIqGm0tlRtNmmalNGZYybMozNNKkxpI" + + "2i2ULJqUrGyyxJslNGpZmtNSsrNWZY222yttmrVNTbWZZMms2lllbKstpmrNMUmp" + + "KqUtptKyaplKbRSbJbLNplZtqM1KKbabU1ZSUAmUaxpZjUkhUmyZmxbRSltNsrMq" + + "qVbNtslSptEzVrMqaazNpmkqZsxExpJSk1itlWqay1KppYopMUkkkmbLNlMymsxS" + + "0TKlNjKbA1TLLLU0lTWalTNMilKmys2ZY2mqViUVKSyksmapVNqSJRqxZSyylMlS" + + "yLFSWRUliWKLJPR487tzxPbvpf6y887/zT6h9UmfSx2PLPXLE2t67TNb+d8616jt" + + "tPkeNmjOnd2bULjnN/5x19I3dES+7KaAHB8sg9OaIHogcFmowcPkd56v4UKiqJhg" + + "oAU9AHxYiJSboAuO2tYkauzYowUsXVGVlc0nYOpihEKtGCELstXcQR40ZwxcKms+" + + "7pFjCoGnlWDFSsNDI2M37zbDfLv3avdlnZZ+BC52UzTjZKLth+XpejoaOcVlvLIp" + + "Bt0bICZGx12W3MemDI+BEABpXP87P4rJiq/on3ucmKl3H2qkVoDOXeBVIHThRlRW" + + "oIeneSsFb5P81QBgJOLBARAX3nH8/r/f8w3ilqIGYIs2ETpWjUrVBz3ap+abPKWH" + + "pLM3ltPx/+N/Wbt1NbzHN6yn49NkVXLjHsi0YsxWYxt0mpP5liJ0D/BK861JPxVJ" + + "KrrKd1DEsjkf2fd+E1sqc+0G02nKaZP3/wWYV/JKhVSKU/9f2kP+Es6z7k/gUksW" + + "JYe1an/921pBsrUdXyfSH+6h3N4k/jE5ItS1VTkajSXnZgf5UtgpKk2jaxZibyd4" + + "83LeR6x6+RPw/T0lWWVLOy4k54wllqVWtTTUvHd5G6VXZwcLVpZCyOySqT/VUqI2" + + "a3OjB+BJ/c5vJ17xaYezrA2WTu8JipWJ34en5WSThOGGFkqslgxWw1Riyit2TjUk" + + "4m2SJs+3WFSYNQcR9lN+j4j1noP93VyHCfI7cNMSZzH2ZNRThulseIk/yU5KdXt9" + + "v7zmbk+gjtO690cSQSoFfmmeBxfI+vqGsirzNH5C+xTw2WGGHE0X+u176U0uLoPT" + + "OEn+qsbDvaA4s+lX8EqpJzPrH0sloeXR1c9OiqmXer0zgSe5ZrT6ScTDZPxHCbPN" + + "0R5uo6u07SaTyP+1LS2qfontI4sTqU/nOnq3gQE3PlZlmWZRJYUsqyJ2P6PJ+L5/" + + "D8Jssqnh8+u+2ca0nxwRAJ32knCcvhmYySY8DlHwPRZOyxVSqrmc5yn+vVN35FkO" + + "yvNZM/ORPMmjIkxNtLVRf1qQ3ksieqJL38h25PbeROj0cV6GFHWIPN2qxXorv7Oc" + + "ifauTZXzYwjFM+LPNWr/a58p5xuD9uXn6b8HdXj7TiR9vZIw7HVkmGI8569eqqvk" + + "P0vhi5cxU9euWvzV52lG6lLCSmYWK8coeiN0jxImMiT1bT9FffylTz7SRs5vwq1O" + + "E1BPxdk4PSI/RJu9WoSzsTH6v0nJ8nrzi+ITko3SqSvxOJ2nukqKkpNLHec/hfS3" + + "JEnzWJ39PoktklpWMyyPh/0Tc9E9Kdo5IemeY1NR+smI8T/dPNYrc5nXv9t9sHUa" + + "mQsqCq1PemmmTVTeR5UqqSopSlKWFOYaL87JVmxycMd8wy5fM2Yw/RXl8vbb5SVb" + + "u3zORyjjG3DhlMKM111l6sSk+BAMLpSjqdn8I5U+moXwXX5p0Z+Ev8Zh48/wLRnq" + + "sVOvKupu7tEKFfaNwYH8/Ci1xHTYAbREOEoEoBMbtSSnI7QnHvPpNvIrSaUlVwno" + + "cA2T6JPxOc9Hjj805OqKqKTKMtvz7PuSa/Ze7Y4TXj0keaMVJIBO6TUtNbu22/rK" + + "Ik20pV+zX62sR+LTYvA/nP8S/x/z/y/t/m/n/s/ozh/TTT0zNN8l832eeZrP1ft7" + + "l855ZP0+7P2fht+Mct5xlvGpyPw3YySSq45XU1bSyrab5ycrjjicbfT6o/FPun2h" + + "kqLVQZw1OrdGyq/AmFG8iUYmGjHDOy2YstLLBnKVZJvoZpv/dskjgWfX0jmmn+XT" + + "9EpEKhcAUlB/eYz+SbNu4qNSSEC7hItGyfhotsOAf9SwdHA8hOJqR/DyaGA0EVqI" + + "SKD6AWMbIK+iFwiWZNpCAwgFlSy1TRu/m2NnOmMXFK6UuExRVkRZMoar/6uXRP9P" + + "7ZP87LZwYx0FWaYU5vlVTqmnh1eev7szJOiq4leaII1cL9t51vM2+LzXlfVqKWyp" + + "WvCVPQwScjU2St+kOba054lwkpIqTJm2mrtWuoYNioqjXh9ZCcg4fauRyifOQnf6" + + "SGRSfxqdVrKlWU2qUzZplGsprUmLRsRajVG1FqI0mwhqNsVY0VqNYxgASIkzAhPb" + + "KKjCrJLVvcYYOJOH+vt9D6MOVhCbzFWO4yRsEfXvzBp0P+0m6q/l61TUNMPwDbP4" + + "A4ZborpXA29kUhELXpos8r3drnud3G50Si5VJtefj+9ZVvVRlXCz1Xg6KThMk4mm" + + "/BxViVUbKrUw0nSUxVm8OjGchs/DpN495AGe5+K5OvXzvbUNNMVStZlSc5ucwd3W" + + "l4u1dm3WlJobdG41bAbKyodIBU0lRgRgW0aw1kwVrIutSyFWNio1Fc3UKqqpRju5" + + "Aadp5fl5udRTjI1JPdwpAh5+pEn8lE/gwPC4SP7yQ/wfmhzK6WLcLLBfzaejXg5N" + + "ROtJbDGTLY1NWSMQ3kPP8tNlbsFLO0khJHEnOD8iIBLHY5E5Vaioqq6mHOzViRnO" + + "TJDV5noj3lYCpbB/UKCPiSPRFBjGEsHZXWOmMUqqoqjVmVmoGFKNXF5UqRqditja" + + "VqjRtTTJJCSNK2SIBLIlcoL93JoaGmSYppju7taVJZUVshVKnwaD0EH7hMmp/h+o" + + "Pbiejj/LCXLxi+sY57t+Gq/cILqWSklksgVasVYdKi3aLGlcq4fh/b/0JI17/hz9" + + "I5p2kpb6oqMezcw1GWkqUylkKqYsxkpUqrKj6ahmlf3ytR/QMwpaUHB8iNiv9K/z" + + "0K6HAP93CkfDPEO0tLILS0pZtCxDEo+smm6SnpFqPN8mB8k84m6eFkLPr2/b9vvq" + + "30sMxTJbKbV41vETNRjrYhAm0Kmypb2ozMJGlqo0oyt7s1+ZqRGE5GDhx9HdIoQm" + + "hH5pdOT8GMwPVn9cd2LOKocJYqpE2fJibmxMRhVjdipjJLKxv8lUwhE3F+9vM/Z+" + + "96zDku8juRY8ZkygVpQhCSGE5vWjeiSSO8ZFx43qYwI0q4xeFMojCEBoYwhDwpBe" + + "iHCkNkSihsIJhUNuES4aChQwWFNLDYrSqqVumBhK0xiN2qw02aBvWoQRkbNJJAkj" + + "HBk/f0jBi0Qj3trasZSWJAABGGhpyETY2mx2GGObpTObWrb351Vt6QURN7vvOMuZ" + + "MryvV8esvd69S9JGxrTRiEw0k5hoCqjCFy3INRaqNJwakaGEikSrNSYRWTRj019T" + + "4CORqY4ubfHfS36+r2c6tibQpT7uqxK5TMRXftJ83l0OEKb1aVXy8jZKtwphii1E" + + "32XPN122+997zbb3qg2rFWEspycmx5fi63iHJ04NMLBsItv9IBqEOmT9g+SGvcbp" + + "+/hdEfGRojRGhaIFKIYxkBlxKkgcNtjbaQ3UpIqYgYoKWc8GtGtpwV4rXQ74tWyW" + + "WrSqxFk4NRFSeaScu5yP8VExZEm6XE4chWxqNGXXVJkYnR2cdHk8WdGYy2vCmNjq" + + "ybrMN1FOOcToskqqI6hQJYpkEaNCNn6FTLldFQjIRVoB+utwbXmdbmWEDBprGCfA" + + "JCZRpKqRYfq2e+7Cq5cNSfueE8nT0BAAmYe3/Q5/hbbwssFCXp+OE9EkGFrg00fG" + + "yXabHiy3EqpTo/Z9bfo+ZtPrQAuNWcI9+eSwSa/nYd7oXFadmUYi1ukq/ac5AAQE" + + "7du1t6q7K4YbOHkbtuq8NNGMZw/VibN2MKnJyZJzVzbk8nnizzY8nI5Pu2KrwXrL" + + "dm6nQ57aXMY8TsVyIDC5bX0WfDw+jTpp6QuEj7W1TMvq8Zyu9vdXFD+nVQXfaj5R" + + "BRz2fkfnvWnhDIyYKVitWiZZUs64DB3WmYY2xUAXs0Cakm2Wq5otBR1e9IE4xR6I" + + "UQ1xETvEmN8IlSLEh0Um6u2FSoE1m8LDpW1Hm4TFaGovlKmdEOVumVxam7bCipxu" + + "T6y5i4+SRHYrzydyzSvjm0vMKixJqmXoTSKKjLRTRkxS7yrSDPFa3nQXLkJi0PGz" + + "Ue3b6kGdih7KjMMNAjQzQTDB/OKQ8KFuO0yGQmIsJJJLKKGQAQmMosKAsZY1R0kL" + + "PhQaaKZWN45u7TtPs7uvVu7uqsd2mxpMjs4adWm7k2YxhWGOTRjkw3YppSco2dSD" + + "nDT6F8LNCzhHRwSHThhZCw/JCkWC0Z4GlllmHQk0JGWItJaemBYmSUfC/CzGtdOZ" + + "glpafCCzTTeNljGYrTsbK77srM0abuHRsdXENonRVgs/PvuqzvZPJURUwfRVTFTL" + + "HP5c+u4dT7LGDtNFEMwhcRariKthqTD1vPM95zBVA62rlBLfaioIouD1obsxmY4/" + + "SLbB1fe/WE5wvNs4XW/dM+pCuTReSLHk06DGF0WkGUHXGlrLY4aDxn3fHt8HuzrJ" + + "2+aMDPlI78q6bHxj5uF2TCFwbZMGRZ9YDJhIWy5Kgdxy7a9+tDiflePrabvyHDj9" + + "YiBjKMXYZIRdTNJHAOT6taIRRhwL6k4WH8MdqdOHDZ5XET0kKmF2Bk/gCivPTwLD" + + "D6OnV3Btj6vA6NAoRYdIDZ/GwT5X5/HRth0F6JgMp8aAo/b8aP0dVD3bWzoGD9jA" + + "IdGjWJpqFEIwOEjh+nBfY8Pv9ThAfIA+v1W1zDh98+IKpRNs2Kmxah79W223bEUj" + + "8FgfYebzbUyGl4S8AJvIixBOhDSmA2GYKhWeUS6ADRDvpmoClc1nZxo2BcF8lMAq" + + "GbIksqALJKpZprIel0G/UM0/NROWO2EHdl8baxjfvVc1Dz9VKlRqHhPwoX/hRooL" + + "hYtcLETvFJPN1IgE2b15FDZI8kftKHm25vocSMiWe502fv/5wLI7POSTnpHiVNkn" + + "KN0f5ylSllDaC8/EnNMn8bMOXdHDBEkioNT/Kpjl5T/FSNstpVTGKjCyZJilljk0" + + "WCJtTbKttU1vQ16RREbZJVRVnrJY8VbpfQ4jCfGExUvOtzOch1jTc+c6fhbzdJ+T" + + "ZjocHhp7tOTg0hqFHEdpzHf3mFU3tGUGnq9aOgRXwlMPc4oqofnnzkevPke8ocXV" + + "cWn5KA/wBIoOBRh4tKPhq0owg6MZB0JF0/BAeEjICzw6dNpJCSLZwqAGV7MVmZlz" + + "FW3GuSbWrY1tbz6cEBX5/031t5Xq26tD0eeTKPanZz5maen48Hmfm+rh8R/tsevt" + + "95vOVW8muQ0/dwn6qkVSPxsTydUx6UtRVtlfoqMjse8kMZUj0SSye7/KVZXR81mz" + + "STUJXk04fITUm7Y+EeH1SIBLCfsshViYpJybG/429HOeflhiyJoizZZJqnHAaUfl" + + "IkvOJH3SKlVJFWbJPqT6ux9pskzdwrJy6NBxBPGkSiqK9nE/6yaHtOaOIlPR5ned" + + "BwjqrLOVGfdvOzy8zy6OTpB8JJ5O35aTvUnmpOHOTST7q5Tt4SqsKqrKU8ZMLO59" + + "VefKuttZmLKmGsVuzxJ4xtmOsbzj7jrHOnDaObg2tvZVLY2bG06W4xJ2PRXowWn6" + + "Q2qskgjIGgwGL/Z/7+qho/gPTXh36jmR1w9demMo4Y8k1PnrL5bLq5qtlHMrhcTx" + + "qkjHMqVQDGMFtMg0tkKYtmljaZTJIMj9NFIipt2BtNmmpK5MDFVUUwrJvjElbUrM" + + "i23kbNn7H7hCiP4ZebpITlFV4hhqmRLE7Z94lSPPmM6+HR5PY6k0ntVq21Nlhixw" + + "sJ52ZHpNNQajs6c9vfpv6ZntOE9LGPhh91dhtbjq2MjZvtil0zo6r+jL2H8eLj18" + + "yGzWRNcm9I5GokcOjGnDG7SaaFYxVOitW1Wmzf9NOstsnBXsVhrLaczNWymFZQmR" + + "BAR4hXFLIMn8tE0KNiGlQnWdm5TOjQdS2GXGiCBhAiR3+IuNtczrWRxLegSYOFQ8" + + "aNwQ5pS1bOmZvMuM2Titbss3zVUdd41y8iQI3cC+BYszD3iyYZAxufkk+P8nXHL9" + + "uAF6kyiw54eRvOBZOAlO2Jkks3WNzvOHZTF8wXjOnz157FNv8IdeqWn4QqxyMzjd" + + "ovNzuHBnGNqB8UypLJspmo/PZrnERR2PqVzauvfqDryP7Z+vQD7IISU+56T4JDTE" + + "q+pP9KlpI+PV4dT1ixJrec504hI0p0ainusxoch3Rf1aTnA9yf8ixfufD/nGTaR+" + + "r9Yxn56qBqi9vX5hPpZKpLI37GNPZmMfbbfbh2nCcj2D8Z5XfTA5tD/UrkhsSybh" + + "P3xy2n8vXr3+fHF+jbhrfffrgpMdwyKsEIABftZxWHn6eRPx3H4XyvkzMnSq9ves" + + "52gWBe8WN0R5UW63ukJQWFQ4oKhAJyCJnQEqDppQlchLgECaszI1WAe5g4MUFyh0" + + "anCQg4mSNdSo2xtqgYJ+eC6eYyu+bd9QOSufIb1aqsFPuqFWSpbKUpWlKojFKpSj" + + "ujZZcdbOTOI0xFWRNkIpGoH4pGFJpP3gr/zxFkAWoqElVYP4Gt/X38U271ZrEysV" + + "o23KuyJZatOZ0Kp4TXVYhqbvrZeRB/cPmRH1kRtuErUZW4UhQwwgBj0NR/V3kMY7" + + "EobIBcOQukBiqbEGpMmJiq+WZWm2LXZ6qn6+3RY7yG3Jww0zZ0a0T9xZo9U2SMjs" + + "PDENqfk7N482T5PLSV+d2a1f1eexrCMfZXsuIkyj/nLJDF6pYr8eHJ6TBVV87tmm" + + "a7bz+ky6PN897u1CATUrOcfrYT7WLUnZUkfzoytVKsFSxI3TkSuWTSN9Jpp5QZrw" + + "J9vP1+nTbT6eldk/oc3RMOhp4yJZ4IUQxBgmiHJjtlz2GvOHReN9+iGp4Jktksd2" + + "Fk4SV2/JatrxIFOH9wap6FtHEfVGhB1sDwiGOwtcvTAgVkF6fh/XVVVUQaOqOQog" + + "5PKIzrA2mJiXdzzLWRbIZCyUxgbN2zVNiK1HWZJuqUsH34W6Tk5MbyVmv9jI2aSL" + + "I2VKRQpzmQyE8pC1C1EUiox5RWwS9UwZLy63VpJNJfEm63WubJNNHJJO5+RurZhi" + + "qlWMUlah+7hqpN26aksmYnEl+2jDzy2sWVaxhxo0sy3GKzqg4dVFnqiH/Afo6ZOB" + + "w6/25A/kKKi+ipEIiyL9rIz61tdfOz5b9tOLlSqe0SxNVPNTFk/XTHSxksktjnfv" + + "TFaebEYVxUzjImU3vFMtuuFx2WDCnNvkJhZJpZDkrlXW3eZtcuKZcvAedJhwsO8s" + + "JvKWfGcuMmSVOdMuPtO5iTO25qE9ntOJ7c8nKZfwxh1UZJbaturhTFgc4VklKumu" + + "lWXlu5AcQCTBIkaKGFUrEV2UU/n8/HpxHWKqpiLFVxDTtu0ZLFI6kEKTsGEUPGDF" + + "OyKFmi9fCJPgqu54sCIJ6uD6eDlOsdVOSppKzATwfi2t4CPHgfLsRZAITsgfqQ3S" + + "VryjsJs6HWRGyuXSEjvQFceInojgi66B/Jn9YGev5OSROQPgpDM311czh5pv7QH1" + + "mjYdG88T0Y6lKoky/ahYfzsf2FLP37iw0iHVc4G1T+qGtRbbYqpbLVXmWjUYsWtd" + + "3blc3NcosbFotRq1lJaLZLMX+yeAaVGqxZhXrnN4O7p233eKV527HTl3dF67ngUT" + + "DIWkYklBhCDIYMo0DsbYvZpkT5KZKN0lGEqTdkzEsUySxKGyAtr23/mYGEIYA2ic" + + "NDzgWF6BTisD+sxSj0YjKCGUBhaU0dbAuSAVMAWdJKS0UVTIyJw03tpPFQtSP5Zb" + + "pmLpJw4T+ko4c5H5d37d2YZYsw/VekqVFiu6LIkAnOUupHbpVuhXVTePKxVB0bps" + + "xhwtW3SVTpJP4oliflH2jl+CLI6HIdidSOtEWxPwTYaOFsTDdMOO9lshLUSxbIu5" + + "uldYJIE/CVEfQGnw3KR8rEXXfhMiZYN1TKw6ox209eLH1yz6Qd55slpUwKmJGhpV" + + "YEWZi/Z/B+/mfovmdoZ+b+KH47xRdEr1MjJ+9ZGEk8zDzXfoia3VNrVu2HqivcwY" + + "3Cn7tM3ujFGxSqYs/dy22jfJLV3mNSTmx6I9vwKifsrmelJXD6zmOk4e/y1x5u6N" + + "kaNqieX17yTTwyGtH46H4Fak1c3Kk5z/ZZaK7PU4mLKJZX6ySfl593p1JU4nVzP4" + + "uonn80Sf8PxBATaSfrZLZLbUFOifY8b/OQOkPKRJYuHzE80n8kWiVZVKKsiPyj7f" + + "1czhH4I6GHur5ngfJsPHxaVDwbH4JEAnRdt8Mbc25sbc26WpK369rsq2Jk7ybJJ7" + + "nc7O76eHpxPLzn7OkGqH8mmR+h6xJVRVTckP3rP/RST+xYn6JzHM8ErZP8IJf7oK" + + "am6yrFq3COr+Gv1fkE1ZskzBUlfkrr8b8hzk8yxE2fNMfNrmi187J8z+Bmx2Wzuo" + + "upumHT834f0K/hL3SkSzQ2U85TkrZYbKMVKVsprfbMMsmUWyWP1W3DVjWss1MNMa" + + "H1WP6OTaGllrnZoiAS6ssfNp5sy3o6d+z1Phfsunc9WPbpmXPm3eqbeJ3nCllcoS" + + "R9y0sQeiKPWxdMHSL5yAm6DOmnZx9/de80IwLgMAwP8AgoIErJWSGzBhMaRbyCyG" + + "/KI3YnIr+zatN5zJm9iJx5FlEPllZszjniMMODP1NDhIdNGSUoDpyr2MFiNFAp7m" + + "dhmsM3rn7xcKDPsQKdNOmEcqRWE10Vn0f5jdKeQdD+sX9BD/gPSY95PtG5r5T0HY" + + "ruV86045uEMRVSihTsyZa8MesmkTJVlLKqkjBRhG+JG9NNZ4h9alqTnNfxllQNGA" + + "0GINwKMDY0ZDqh5V+GFsqw2G6lfuxMZjyPPPVzVO+/y341ul3m+NvxltY2IqNsRY" + + "1tTEiANRtZmKiypqJVJKtpSltTk/sPm7/O/dRNKm7YOQYxq6uWOcR7KE3fYnBOUc" + + "rZ8tbxGpQnw+T1h+E9UnrJ+6E4e77/fdEqziI7b4QxqWvgPVY2JuUihvCTzqWzax" + + "J8k0/ueZNn2cHv/723l7vkvl321HbIYegUM+f6eVz7iFR6+P17uMwF+AHuHwfOrG" + + "7J7tnlJLoqxiJZp7OkanzOMm8/JPR9k3N9px0iV2kiN/2MZWOp+Dmehw93hD9FiR" + + "9EvPnH5sfKX5VzOWREnZyUU+va6YuauVpl1jSzGGKqpqKIOVA2BEIIMpS3xoVbiJ" + + "DZ+4+ep9reEaqbrqJ9X9jOrrvJSr+/C3LCqZIomMTTGl5droWwvUnqT7fVasJ7Q3" + + "Vdshbp9jH8pBJ6bD2U+Cd/hZbX9ay6kU8KxTu8ttbZlm1Zpptjy1hjMVabYxkKUR" + + "gyjKMrbFpVVpilVWFxd4lsXb8MOW7fVipDJxhwVyRmzTVLLxkzco2dz5NnmsjnxG" + + "SQ0xLOUGItVGqYkjaPOd1ixXJ8pvAbHrxPhNAgJ168Kvepi5THZi1Orm5ld4ad8r" + + "162e8Lnx2rLKuWUXYSACKn+0Q+UPkiWkUT/jy4+mbc//nw1tlzru26a16nw/ipmj" + + "oukAwgMmggdSKdGbGU/Iprgvjn77Ct2WhTTOcy5KZMORZMZRWwQ6QquGZW1JTVlg" + + "QmM8osKKGDGMJIGMIBsiwhShSkqxMPy+3NPLDrbgVBbDqzyCBgWZKJrEQiRzR54q" + + "wia4gUepCJo2SzrcVXl3bH+sTOvr0qFHlmMYpGEQaiFZjEgQmdarIu7T2kdmRlAF" + + "SkKsnConJTZVYwmzOAdnDjWUlQbpLqEmzOttyWq429ehDBlMRRpyaUji5o2uW/LZ" + + "8wQgAFSMYB0Wdnuk9X8nH0naSH9JI+g9o2Gzu5nUVw9VrujeRN048OjNoP8LOjhS" + + "uG/rTtFPk8g307qhpyc48W4wop6dLpbpG62VarE1XE8iOyVK9ztXvOYw0JoSwJZJ" + + "Ftfft+V8JibSreNomUqaifeYC3fJ5fCnZQIMR8DDQUIxtbZGzGjKKNDyRspoqZqZ" + + "ossZ6UUDMFZKUgwYwsMaaYqaYrCr66wtypjY2abpVSX/mXeSNkaJPqgQhw2mmMjH" + + "EHymdzJLzYsvmuuvVbsqy6m7aYqyZnGoerqj3UePiyIVZIoqKthYOZ6vGFsYpWJz" + + "5ns4SY/yi4BSSyktv0dXbf1b1fl9fp9+36YjGvdRRMDFkx6Pp9wzFt1H2f0Y5CMb" + + "VjGyUszErxN3k9ks0S1Zk8IeitT1VrI3R37ye53Th502X+9254a+co8o7nMnWdCi" + + "wosHYmvktSVSyC6P4FSTb4evj8e+aNQ/gr3by2tmlU3bI5CjjaesCuuOTInFMxR6" + + "BGGiWW1NjQqsYxKUlU0qtak2QF9FdGkKOPTjiqoqd6H0PuA+KaOAwX65yfbt0Uu2" + + "t+9+OvxwswtdK+Z6T46z9ur6JavYqrVySsYUxinbay2mTZRVK1bWMy8Hm/TRaetZ" + + "W+L6HJ1GI7KbTEnokj3nzVNViyloqqryY4aU20msYtW5mTfBtWDH/fMFA6MUxGMR" + + "NFAuSNrZk1GrtLMg2RpFCqVUaUsYRZMiN2Nim9bnyPI1L5d7amo7nk142ZMm73SJ" + + "/eoPU902bpY5T5yQ6ffJkrLbKvs844reynK6fNsroOIGSOqTdhDZO0IlkpYiq6Oz" + + "Fkc0U/fPTYvU9bxWXZeLi5F902sZZU2ysGSmlVu0qcXTGyX5KS21VKrYw87pVnOc" + + "iN204sTwOM8R5cJLXpE8sT3gdCaTqejSJPFnanubqkqvQ5+EkEjrFki/syRPSKqx" + + "ixHNf1x69+Xp6t6l5LGF8d0xI7umlRgxkIYgsKQGahBGMdwkbbIclCjg2oW00iZA" + + "hDSVAoDGhqhIDTC4UGjDNVSwINaWT7/c+6B936RGV91beaH+tFpClUqVar6a57xS" + + "1YsdOxwxj98iTq3teHw5yT2NnV6Ms+s+NR8b24bKw/NWKKqqZhiqnM8QftpfQb+C" + + "Vs3lZLSSASqcfM7yVxGYledbnrN50XJBATYaCsBtFYJlZR2SKwb21+jqRiNFI0Sa" + + "rSjgiATZnWelW7O0mbziCfju7ylzo7WSqylsYp0JpjJU0qaMlJUUVhGilWTZudCx" + + "M+kc+l5uTSG84qLYv2ZJMli2qrILI2Tqln4cMqNhAj4gogAncslWOiwaV+BwnPnE" + + "jdp7E6UlqPtYJYV9Tg3WI95FkO6beZO8nlbeyYVc7od2tLylZPKLTp1I35t2iLsk" + + "ipSBQqtbUX19H2kWD8z2PyVPmh9rLUcrDSKQsTJIfukqY7Hl5DzdPLdUqq1+LJp5" + + "emzvHWPLN9YtWeh+2WzylkbFNlTCyVWKZpKyQ4YwqnWq3kKzCwje4lWdzTuDbTZx" + + "x4bJ8tzHGu7m3prWSakaVZncMwY02dcu7kznctvM5MknBXCmwVtKfU0xWphkowpi" + + "VsxiVW7I2rWqtRhwpcXDoaZN1MN6tYlKrh3GpWUlJLvXd43OuslSWQ0fVcxqeL+B" + + "Xv1rpQyBqdm7e1Ra8loulyubVzbXOGoNVpN1/mjcbxaAiUP6xnhT7z2IJaTCQVgt" + + "DpQcGFJgWSBTA5batqKV5l3ruu7XC3NyZRFeT486vWm68lRqMyRNpSzSpsi1KyzL" + + "GmTS2azSVMZqtq2bay1a0raVmmyq2yqikIVCwBSIqSpJJKsVBYgSKsBLSopRkS2t" + + "tKmrVKmA1rSpZU2JTWWSGtUtmsrMWKVLLVRCkSkEqQS0GpKlKZllNtK0WFGTNpZY" + + "2lmmZKZLbWbabW0ttZTSTFMklmzbbTaajUNZaVNKzWaipYqKmU2mMk2lilaVplhZ" + + "MykpmlSwamzZsrUtUJCNs2xE2zWbLJpmmmlSyzaYzNqWpssspZTaqtm1VbJlmm01" + + "kzUtDKks1LIK020pKUpNRlKTSlmUprKzRSmk1NTZZJrNhJIZMlSpNJDMktbNVDEs" + + "mpKFKVJtllm0ps2WzabGsbM2aQtmsJaMkNaVJmssNbZtbMprNYqWVKlaTUapJmGz" + + "RClCZhpmEmZpEympqWZmWbRs0SaY0lNTU2lqbLNtts1tsrNtKqSWmGWWW0tZrNiG" + + "Uy2ylLU2jJWUySmlNmpspWFKJrTVkE1lJmakWTZmUtpS0rKyqpVsilmsNrWWbLMq" + + "aVLFlNmazabZtNppoZJEkxlJIlplYbNUMaaVKhIUylmxaWkEslm2WoAZmYGmm02k" + + "mZ9vNcym/zYZ1m/E+UySfg39LUVVWb+0CAnu+IVnzkTYexs7ufDm0VjDZ7mmLPDC" + + "jvRkCK4NH4KYIPfTEsxAJVJTCY4MNNqKqTgrJkmjRkVkyN9MMuNskxW0mmjTSlSs" + + "RiUzxDKZmvWVXm9Y8a6VLqbbWXtSMLsZGTNoSqYkyYjI2VEskoLRRUbRRsbWkqSt" + + "Sau0WgopMsq6V0SZehQ82kyxbJsqq2k6xbaqqpy8chxElkKVybMPBqa1jIGLJqNa" + + "WSNnw5w5rJRVJ8pXQahwWUzyp0wnz/U0hIEiEYfzEVFZGtr8GqLFqNUUa0pVZVFV" + + "lLVsEy7VF1qILVeGEk2aS+WJki7F2pqD7InRyG/WjNbxTzY7E029eTdr/1ZJlhzx" + + "xZEk7TYxZI2Vk4yI8WLZEUcfOpyzjm2I50sicpFjzHRZKelYLMxipnrpolbK2wP3" + + "Gj5QrZ3mE7dW70dJN3aTWPvGzFnLOYscQkecNk/KdSbVattW/g8tatRJ9BbaVmTU" + + "cNkbE5NiRgCjqJjBFYYMQEpXT39BIxlLWwvLhFGpGWUqKViqxkcZkznhqQLSNrGQ" + + "hBUdGYxN2kbWNpAzdTVXSs46S3TNK5yd26mxXO7tXNdm0m6bRbSTJvK6rpKW2TFt" + + "vPLvJbNaSixoxKyEmNk0kWK0SdjZs2NohYnAsejhFowruXCQlUVFqVGpE0UGZIZE" + + "c3lktTo03a6N+EiflSdFScJJ0xKRxN5+ZDlCLZB9FWySZUtkhL9OWNS5Kx7HmGk3" + + "Zm+vn/kuSquatyCwYtGGhIxpQKVBh9sws7qnJ2thu+NtlbJbljpdXFmFp6I0cN3V" + + "hW7RqTNacWNJ80k/pbIVr82CR/iVzKp1fJPyjz7u0PGnOl53LbDvYakR0ZJD8qm5" + + "9mWLpEWRzhu+1n9OUKT1kn8VOh3p4lv5ZjCqf3P82pWjKmxUzVvxpOH8eDZPhDwf" + + "ii4JZZPcJ67Ts94+JJ8JN6n2RXJ/iPpDEN5uehqR3Yxju2bXbGDrRv6T0R5vdxJO" + + "R2mD+4dUjVjZFQf6RFZJ8rFskqu7VMy3EjDuzE2K5wH1nnG971lZjE1GMMpMLzVo" + + "tmMJoN2gv8yApnCpgihcVoiUFH+c9nnbz+momOTD2WTT5sRko0skZYttki1bLSVY" + + "mmMY0wqhWnGhdSllSSW9z4amEW8VfPq+6qyaeu2jZNvXtEl6ptryvUoxwqtXN1Fm" + + "Yqyc7Jqlsb2TXkulki/galjcAwqxIxJEkIZjxWvohjDLbjDg3VHCdKtlCUmTvHq1" + + "g1bKsb1nufaqpD0uQWNon9Cdrrb3LTMlSbUTSbK0ohajIvgjH+99Bt8p3n6qleSV" + + "ZE6o9h2eHZRzpwc3OYmK009E9R328jxMbJvFH6StQnM1NNmLDBWdD/DwdQc+bD7v" + + "Uoz8D4pQaY3jgmo4UpCiqrGzZpNbC5h/TXGpNqn1Vaok4ZPk4KphiwyWJy5ZHRwf" + + "oiZC34h6SrVlWif7FRHs1+Nuh+L5Hs6k7WWyNKyald2mpMaNp8+jr5z3H5HpDpU/" + + "yqPXPAk91O6UFo2PK2u5jy7lWy35Kw+iPIqfOySOpNDJ1k4nqsilXhkeZbW8c56z" + + "Rx1kbkR1nBpJ1VUPWotkR0rdsQsexSuL+5pk+Mk2l/i7Oi6XGwkvE5JyD6Ifc0l8" + + "iIBO6c0DixXt8Wk0H6+6WxFliWWWhO5P1UUsfx/o/JZJ9iprtPkmjEsfWdqnbtat" + + "q24OckqqqnQw+6k7EfBZHMentbUafUcOiqVVVYFUlFKKqejEY6Y+lfo+ubdLJdCu" + + "RFXLgVQwrGW3GIYJWGCYwwtWWlUskYxZ+emKaZHyQfWMWTUkP9FV7wTx+WRVUrZI" + + "0/KPlYWlUqaINRpIxmMlMfoeftr+7+JP2H69M/jD8xaKRKgSrdibLHI0VxjbdHGN" + + "jQd0aMDA0QIQWEpTRDGZrq3R00OH8GFjuAD9iwhU2MP6wiGD+jp0Ymd06Ksv5piO" + + "Uq1rMkwZkiw2SmZIUHD5pP5P1qcNmkgD9vum0hi+X4S/PJ3/mfi9rbspyye2Fk1Y" + + "tSqo+5O33q0nAeTHbg7lc2zBxS2K2xjL/dLmkWZGHQNxp9NkyrGxuvp9akHp3+A3" + + "ROSdXUb1air5yyvdI8km6PrIgEskaR1ceOmv5q4dpNp4dofKup3NzUTxsvxlZbZ/" + + "V7KshwsVcSqwxapT6487uYnOE9IdPT5DshyR8GTg8yZIxO7D2Xoe8wbPD2vkrki1" + + "J6oe6xXDYppjTbDezUkdjZXVjE75bVWXRUdldu05D4OvVbD8SxVZLZ009nJEkSTN" + + "7Y8kpPWH5pUvT49iIMA9AfIDJEZQpYI0oY5HlZOHxMMSe9WuihVMpamSnEH4RE9Z" + + "aWlkKsWrVSPdFT2zJGJOHBVlVUrpTJRywuMlV0T9myzARkClqiJX70kgpcYzsakR" + + "kiRXw/k/H9sfrouz/j/oVDN7/u1hxCRIRZULOfq+KvHsxm1M2jkhY7WeUc1j/ARD" + + "X9g55b0y0OAkCC5cP+IWkuBkJyInN3reK6uz5oJ3cmh5kk5SOROSWbV3cz6GtQbZ" + + "KFKWuNFtiyrDpfLMzGSYWFVpVVZYebEEsBqBXBsjMbarG2x/fZQ+jLYbHHqNwzdK" + + "EarMZjYxuuOPbI9sySN6HDIRKMbSRBlKUoJjSMbaV15eryvBqvJXDYi8l107GrKu" + + "rrePql/G999PfuvQQNubc1orFGJnz9/3e/n38NvhXHdrlX0hVyULe2vF4tSELMby" + + "nXaVdIyzVzptzbpG0kYyrYmUstRUilMV6qhiUaXUqU2t22sqVUgIrrtLQ1QdExSK" + + "lSKNIKNDYBCEhONtcvec081daISsVrnNwhsmVFh9UnkeSpU/Ucu0cHJG1Tws6MbG" + + "5/FVq2qhSlIpMbqkdPrfnJsRP5LJP3kl8j+YotqNDkj+2rYWxbJPER5OzzamSJYm" + + "ofxdXtOqPt84dU9J+/4gPBe8BUHiJMP6uXrNpwqwttVSaxGF+jEifCpFfxSkr9mc" + + "32c3S3Szbd2ZoiFIb5ZGYtnEkdJ+Try/CPL9Mi5mMdh+Ug/lZFsslk+ZJ6Es33Tm" + + "ZHKzR+qo+jHqk0bPR7vVXJrn+XaeaslpRZLB6fWTy0fm4NJO9fzVkjpKW2+cmMea" + + "KKivw3yNm0nsxo0qY/JPx9o926TeJg2Itr4mV3UibG6zyzGVVRZRZzUmJYrYjeJP" + + "tG57vdmClZ7rv1y8228aKmVl6+qvZfKRcLOG6ldOqd/Vu6vnzdTvHSaWdJCUkjhk" + + "kn7Gk+eiZHzRJjshqSwqyDyZ80X6SPqx722PQanWebyOhb9n7djstjZ4dY2OQxL8" + + "hdS7hgfQ+5CDkj7o7K4g5yNpyOpPqRywlpQRSDKSubGQjFYyaHIAwiqRam0sMSLC" + + "sJviL0yJ2OkeKEslhZYLLIdXuqTrJIqKaZP1acJCcH4eh1+kfB93b1WTnIpa+SDt" + + "JnSUSfEhNliaKTnK6bk2NUtOpwxwxVUbNmx5x8lIqppySP7fkeJPkfA/GZNlaB85" + + "U/xOGz7nG7VxLbFvOJRc267dY5TS32y82q967Sok5Aw3FStphVLMYoq5nJ05S7XG" + + "3bTWXLtislaIjwcKpUlVZ5bNl3MjhW/1ibOUVX6bGO9ltr3qNM4ZOuTmdlJHaTrd" + + "opbJmZI0WRqsr4Q/tfrZ3oi2RVBaIqi1MzEkmVJ0pnG2r43k6qGCL9Kkpczv4SeP" + + "sFeTIEBc3DtAZcH6XxGW7Yaw+DznoSqyrouIMcMHbjD/FBny/X179rvtjikQCcgQ" + + "E4HS222zVI+KD/aP1IS0pJSBYzn2USdPSTTu868arlGQodZ/tyxVyU5RrlBdEqjR" + + "+4KCHQDi6aQjlScf+T5kjee1Xoxo/SOOyTCd1xDlX+YN/MVvtOj2tXZXckMqqZHZ" + + "EKEQlkdnL7Jdydlgmev89uU78j5cSJ/l8dkmE7rhzD8qadHMH4jZj3nDGPdwajh7" + + "sMdnVu5ujXXl+T1/u4LOHgw0+z8FGBY2M89iIokYQvh0gpDsMgXC5N6MMVWqIDKF" + + "k7Bhi7LCa12ZnoYVi5gcGP9X5TyVn5jjpmK38e0H0yNy9sy6krJx2NyXEkufYjPY" + + "35HJdzHaIWeWpGch1C2GpaeIIyAyJiVK/Gotmvs6vH4XixysdNfO67ZuafPse3Xt" + + "czmeH1mHV6i2qvNHrsuyeFJj1OGjd4Zq4YLjGTExlUsVV/xcbG0nNuxlxTLllUUB" + + "hE0vYrX0AxuvoyLWYktLUDBX8H5cYsLkOfeXyz9A4QbZ7J00FTnG94VNve5NkYen" + + "LptnR61av5SHOPZVdEI2fk5/k3VxOX5PckzZv1ec8TchyRzOOqs5zOUkm0wWPJVW" + + "TC1sxMVVTWOfpWxnsx/JmyBRsFWNsiIqoVUFReZrK80s5jqpOqvOS43zEuyOx1cp" + + "0Y8OhOW7ME8lk6LCeFLjEsFSqpSyelXJhXAcdpsp0Y6/OqpWhUMVm2xjyTgU6nrw" + + "6yszFUttktLZVtnXi3kuDRtDz/sJ5OxXV22LVZKMYxihA2Q/Dq/NjZ+535t7PF0a" + + "3E6sM0t90PBzJHT5SRrz+MtSHquWXGSMc07ChTvJ7sjSm49U8JK0NlKrXIMbnnPC" + + "0qUqjU5Jxyt7ynN5e/kM7y2YxjGrVeTE5xqbVT8LiY6bpo+ZdRG82/fr1m22xZSB" + + "38PxIyNMShQiH6G9hXLOZK6w3N5+X72HFAxu5NSfRpW6afRXqo8VJGH9x5ObPuVJ" + + "QLAiFlH6/u/FbMJ3EnnDq7T0En449m8JHNPxcyzXSV7BCP9JENSIjTahAiKfMpQX" + + "fhvwg6xjTyfA09UakjGjZSMkcm0k69uDQkz5aTWCW2iz7hlcSciTjD3IoFZBYmNt" + + "odoFMMIkDWQjASGk0NA76DcIySAGLYwAZPQkVbS9raOCXx0N4NPJAcpTE24YEIYy" + + "g7CfLWmi2E1TDcjdkTMXE0qKsqvYI1Rc1zUWKjBt3dZMYLSc1V8teNrSwW867u67" + + "u3XWz3uiTDJ7uup6aktGEa9d1hTNubvV2q883d3IoqVnZHRyRZT547K2nlbs57pm" + + "7cLQoYwF2iZPBBH+5LQ7dYkkhI6u5sNK9nPxux2bnayrYrkTq+u7erJbBUNziMaP" + + "rppVcY3SxyySyySfFXkjZSuA61FVMKi5jFHB+UxNKWOqcRzfOSQki42nkQs97JyK" + + "5amm58SFk3LVSU0uj7SQfqwEfho1r92H6uG22K2lVz+Uf5sqP0dLN/GejmK0sxrP" + + "xz1m2/05yx4ONjCbJH9A+8QkhIqoJKiRIQWkkRKAK20HGfR9lFGh2vmzMyyCig/w" + + "mlAinByNccszHu826vNs08OjdXU3GzSpwG2/sZ6SHoyTSVw0slcGjSBnq4UMw08I" + + "tvw4uHqDA/w6OSCRnyIh/MH46rxmTFxdHacVc+uD3HvflqHvL7RI7e5edJqb4ZU4" + + "09uYztwe+W/IpAaOoyLcwQVPk3k69Fffn6zXZ3kION0cYOXDuS+3vzTOm/K7Mq6H" + + "OlZUd7Pxxdl9t69NorsK6eU6442+am88vu73UsgRoV5Z211tTDr33RPyM6/XfL5U" + + "EDhtlOMGIOhqVFDMLDExeDQGHON0fZdtpnTpZ6cD6JBkGJpUx0Y0WuppUjCvDGzH" + + "Jsmjd0VyNNnRZ1Y1MNHaMbOGzcp3VttssZwsk0gsTGWj6gLXG8FJpoGGjp6NmZZI" + + "mQYvcYoaIEFW2vkM2ui4SWaSMLtv6RnW2Q1A4FIHgMRpRK4eNjfwZ5oqGaaSMo5b" + + "dknhw4SbOELPGyXLyqGoGSSqSomY1HBBVkQqys9MCWL1YjTEvrT/lW/HvnSpG2HG" + + "W0YwPtoufZQEsPWkFdi4q6Bs3tkoppX5Eiaqo5JX1UtH2/gzrxnmXNzE5gfF8iGh" + + "wMagId9OeGfjPxGKTtKHVVJ7vT6eMIaVB+wH3n3+jxV4Svh6l0hS2vo/Hxp46W8T" + + "mStcsHMrio8lNypolKYqrT5AyFDChtZGHuINKBspBGKg7kJt6Bo8fNBswFHISJJt" + + "PcLdHk1+NWshZCgqnMZITrDX2VnDFGhCe+9um2kaWy3BLFDrBte5ISqMa3whRNX2" + + "hdsSnCgdmnJiwaaFmqxgEhoSkmS4W5nnc2pOkjMCi0Pn4WGjUumeTCfLJJ1jYrHx" + + "jaFRrCj5qXWxkTinm7fk9Hu2JvELPk8MMVKpWKtKq1iVVKKUxXlx31G9Tw/vO6Mb" + + "E80lYmSJp0FRrDJyLJ51U9ZI6GiLTUsTlnZqBqxHcOldSSip2iosJI2Ehx0kHxDZ" + + "/AZNzYUGDTXrMplachkVuS1tsiYIYyt2mzZDErJJWTTEalrQplZC7YM+li2SUoxV" + + "VZY0yZkycNIiDcCJMaGNe5kXBpN+8HIUgoKqYnY1JISR6tshCE6JhknVjg6cMhWn" + + "JNlbSdppsotV9zG202HYjiEnmTz+E7xXhSrLv5ZtdazVbW2hjEYNKDGEBkJ9/vy+" + + "vnrFURs1YvpvLuyE245w0VLL1kr7cOg/Ba/Qf0QM8JPxZLLOStL5KZ+faXr7LE9j" + + "17oH4+OiR8orIu4h/RAagtxGICYpOWtBCN8eXMu7rl485VKQmKi+aU6rwbyfLXpr" + + "161+qbettfqWN0pL88tJbgpKWur4a8ki2arIszGhZJVK03h6o84nieE+RSDA2EJn" + + "ygppzrRHjjDHHjQ3oAGNIa0QIJjBiGd8s3glSnsMZSEY1I4BqCBOrFtgXZ7YoGff" + + "5SOeYkWToVOR6a7/Dmyl7pPebOTUlLEYebR5Ikzr5O+azEJXRy731dGOXtcW5mTx" + + "HG7GnHVxIbSbnuyUslYdMltVhpO7tytjo3Cx2IyGZDKmmWOxCaYRisSq0VhSVpit" + + "JWkrS3VY0DcaigxKkRFVBNRkkg1UhOMurldw8knJjznZobpJOCnNMtmM9JI/gses" + + "Dl0es/T0c4b+aSO5yy8it57PtER7yQ49svq6K2KoqVhjFUqmm02P9rP+enbyTaJy" + + "k7zyB5VdEyRHyqE2jlT/N+4jPJHNVfOPajFtvo+bRIhxDIiAREIBEBHmAseJvCKp" + + "aWSr3OREAnaST8LJp9TClbcGN022eOxs0mObY5x+f0+u0ck5RKKUopJrgB87bebv" + + "yv5u7W3q/fvzQ+JGypskPUreRLIrmybatMsX0a/RksaxtIKIX8sn739qsebzOZiG" + + "by7s3vdaJR6Dj2macG0WSRT7SDN9KC4xmGSRgRYwaf7MbwGIOPrP6Rb8N/DY1I1H" + + "JIkrMaQbxJHdIbifDkh15l2d27BHRHVPKch+6RBzeUnBMtctc4pKUyuu2upJrlrq" + + "667pW6+1t+6Vk20JkkpYV59A5unxbofu3vn21Ey/s+HYx9zasPu1JNm5an1x85Hp" + + "GG1LFk0RAJ1kfSK+E9UPntJMsjrKWnc/YuFg5pe8Oyx5qIpZEbwKh7e7yTBhymws" + + "JtGzb8PDzkfvPfLZJ5yR/o9pH2H9KqdtVVX7VbbWI2Nmr22lllliKehVTXVI09Cd" + + "Z/Ou/e1aKs8lfvPiSD3/Bks8PeYcuVmGgTKW2WyVY/isZRxJN2T4vyfP0vRyfZZK" + + "rbaZNZsTidKX8ofEcnunxzNEJWu9xbuQ3w1er3T4Y3g7/gteJ4WVbTtmn85O7lJ/" + + "VEnkTJ9atqsYYYeujDUxIwoxR56sknNj7SbuGneRs8nq4fJO2cpuiWKioslVKlRS" + + "pJZ/ULtdlKi0b+Z81+yixKtJIPDdvJ+LvDu0SyY/h7/w/FiNs+mias1cSpOznIPK" + + "yrHt1CY942YTzH+yrZIoqhOEiZIT845d3T6Pps/6Ofl4bEm9vIZB/UJBbEtgRgyB" + + "QrgTP96/o80lj8FrpZ3WuiX6brraSSqxRuxjTFUbWarrGGKMDbBcSioFSqf3ZLaC" + + "XBlKqfB9CZLWcmutdlVXXxEzqHZVo2a5uZjrbE5X5CvSKi2WpbDaOR0OqaV2Vjxq" + + "myEND13YGGgTBqRBqAkgipVktsk1bJm28lu2ll5dkUpklpVLKkqjThs7SaJqeWRG" + + "VasWSxZLZu4aIgE5GtmzUkyWRexTG+WO1qi40I7X+GXLi6g1d5IU5Kydn5ZoeE4k" + + "iNK7HJJHZ32hk/RzVTRzKwrOelrcXxZCb6V8ambb6i+3z7g8vV7o2qRK3bNfx+d9" + + "az5ZypWyvNOJkq2zTDGW3I2kxsrRVg0qaU6NmxvJVssZPf5Ch3jJZiNskkJC5thW" + + "jziKca5yYTlK0RAJy2l5f1mHrY2Dc6OkI2TTTy2TGVsRATPxGssjZRlnpIg3iSRi" + + "xI5OR2SOZJPl5/ncvR8vln1Y/uaaeTGFSl5VO11Z1vnvja5W9Kw09ahkgtDDYyAY" + + "Qw/WRKMp5aFVusKrZpjSKdZ3v58tazxmJb6NXQlD2AabBtG1MLD6P6xKQChW0XsB" + + "77Y5z/JBkkMXpKgXiWquYcP3Pv6+I4oBI7HediIrxI/Ei95EsFOQPxkk78pP8rbI" + + "tJ+v+lu6eiHk6+Kqz+L5PSR4npITj7fgsgl+q1VWGLPweJJjUnC/Grtc/J2G01ZT" + + "LW5ObQ+bnkr8xJ/5P/vSSP+C1jG1YK0Y1sao1qoiqxtFbG1bFRtUa1sVo1trGrG1" + + "RZKNo0UFSilTNtRtGjYIEClGbbBQhUJBpCDY1o0bFbGCxY1MoNG2zTaLUEKzFBMN" + + "tUbFY2iqKIjEUlZKixqNsW0UY22i2g0agirFbYrFtJiNJbSao1sWMUUUUbWNslpL" + + "WNjajFopFMhJGxRRttjbBtYNtoo0YrRqAKKLUkmqi2sSVY2oNFaNotsVoyQVaNGo" + + "o2ooqxaNUUbFQoYQ1o1WLUG2xVgybYtGtFRgmVk1iqZFQlJrG1sbWTajRaLFaTUU" + + "VRtSW0bVFWxasFWIsVosatiqii1GLaNaNGpINqg2jVoihmxFti2DGqiqNFrFslti" + + "qMZJm2sYTbGLaiKiNYrRRGsbWLbQWoi0WNGo21irG2RMpRo1GK2Koo1ii1i22C1i" + + "1RqA2o2jbRRjWi1jatG0lUBWzNUWo2xpRTRVG1G1Ftii2pLWTahQqKi1otitJqNU" + + "lGjJNKqI0Rq2i2yaxjbRqMUVYjQaKwVRtFjWiCyFiKsRbUWiosmsaiqjY22iqLQb" + + "X5/99f4p/uUf0tf5/9K/qseg/3/8O3Ejr31kY1gc5A1pvXCxCkNiwvOQZYLITeUx" + + "5CNobGwqJ5o3bWtQ2oqajkZRrRj1prYW5TG2RkzhxibIud1zezbDrRBn8s2xsbHZ" + + "Ilaaujw873Rttris4cJCx42DgiHZM67LEm5mczQU0zdbGxtvENm4RY8axrs0rvvB" + + "2Lmhu9ZH1rnXlfnhQMwstTWMgZ24VXZJdzdKmphdlKOvHF5Ypc1co3WpPG5UchDH" + + "HthGXu6jHcIFa8oQrWt53ErY2jQyDFGQGaaj15BbvaLTDPKU2xY9Mj2zrW2Hba2J" + + "jEwZb1mshmPWcZdXPGGDOQ4hqWsZbxqyLQ6ysx+Pu9UmOHJEyavWvHjbPPnsX1XI" + + "iq+W3w8Tu+Ry16Js2+QVNGKUjZLWwXGBxtiE2hFTSXGBGkBjMu6xtIYNFQM1yBbp" + + "9u0ksTStorHkolJ3E5XN5tOFjhjhwmVcOxEtLHxyyr7N9lk1DJaN0qwpiCBpBAPG" + + "3V0ccPvd0Avs82rSKmAnj7RQAdYSdYbzJjI4URnJfO3TT4xQ26ahpseRDUtS+MKb" + + "aVjQ9wg3lnedmecmuQV2y44ptKaHyuZcF1u1JXKJlu6pRPSTudsbp5qixXfWcnpx" + + "PboouIu6q3vjI6ci2PuVosvF0bH3kaaLyFWNsiaLGxxWqGnvHH4d8MyQpjfcyGZA" + + "6+PHVbTd22SxshNhjBvMiBiocsG2M5zFRj1yyQh5C7vZX53zDy85X19hw6XAhSc4" + + "4HRB2w2Jzqalk90qqeRM9JrLjIlc2+tvhMyT2eUuq4MdumMqyCenJRHTk1OZudfS" + + "+VfKOcyA5HHezeQrJxq2piOM5vIJjY0fYvMt9eOLt3WsvDtG97S85zOs8DAjs7dX" + + "vmFFxB5l4hvFFWKjG6TIUmyWmMme3cQzNyatha2CUx7UUluGUDYW7GzYGPvUZVUN" + + "2QruGNDbQ2NtNsoEDGs5S4Sw7tuXObFDTJmQpdzuUSm7gDGi7IElwyNbNWUW5apw" + + "r1xMC2oS5tUYZA2cHGiAzve7XardJ2IuYysvZR0Ku5Ck+2RL65bzSHlFlxDxNMK5" + + "TWUzcfeFomjrOXGkuCogWNpZb5Tmyes2YdxqRBmU6GoIV0TPJNojDDaqLiTC92lI" + + "44VORRdd7f/n2zez072fHsVc0lJBrBTJO0dTCCHBnnJ7l4TDb0xvuQrWjqhowcNm" + + "KETZaeWn2MKO9JNMjipkZF31GWlSxcYpJydb5hSnINMGPuEOnRLL4UV1hvIPGKBl" + + "ZvS4ydl0W3uRzvMAxgqY2gIYc5EjKevtHG5vkRZfTi704pm64VOlm9mnddnhX1d8" + + "i11nlLfO43hvIUvkhnaDTed1UYzb4SQy8iOZJY0OXGtwdkbrl6UMLqQoOxj6wqcm" + + "67PRzUcwOOdgLJgvlpWuyLe1MNGlSR9cdZItEm9xaWRy5l21raQcOMenbGPjUtId" + + "5L5rfXWQr2NbGd5BXI6+tVcA2rcJgTsa6HJhyR9JZrTaSuTN7tG94c7fN54bJ5gK" + + "AteSmybgHEB3lSGHTGcmecrPGjWNw+WA2uNR0erioM73usN6veTkgxmQtzC+7W1C" + + "52SQlmXcODt80oUQQutphmedzHoa0Pb5uGiUik1kXE7ZGybH16ydOZNOpe5Sgesh" + + "jsIhgWSTnObvd7JYyX1O5WwQQTtFWii2tYujUsWbw0ezmrTNw5aVPbIMBpLsctzL" + + "3e82boiMG5yOnOmm8fMsldyWw025uHyFFYaQ8uhZTsWKiNp8JA35OM6ztkc5IRzb" + + "yi5eshOO7RfQUENxDrF3qvnKutTq2OI2Axlgzi73va5to5kVtHbQ7Y32Dd1k3HCj" + + "LIPSN73VuOclVLYXpmseBJzbNvLSDWByI7kReScm2jiac6ztXZGkbaiCAyO2QzIX" + + "Td7J06xss3ieAXL4jMoKMHsszhnY2tu+PYncmERURzYjb7rVmXU5FSXuzzzvke8r" + + "flq8UMwGzmKayKZkWIVa8gdUzJzlgqDkEC5XJt6MpysuebzMk5crS96OkqQR3Dkz" + + "ElgmcLoCwfLTbkIR3GXy81m+S4PlrND69sIGpuN6O4g2ktmwgkuHKu9wyznIiYqH" + + "xh287t87BEPFkERt85JvWK2OrjtJEX2u3Obs84debd0rw7zdeXMFzOZDJ3NvLmvO" + + "W98l52eec8Ovx3URCkNEx+BY1uglDVhy3y0UPJcKyiDZjGbewQ+bM3Edm6FJOvzz" + + "azuclkGaGMcYNlfJEmxcZb4M0d5vObBOO3PN5hD0onSZ5O7GGzFbRbOZzlE2Rhka" + + "wphx0zrlixjRccimW65Ok1uZQ8tkA7rSLGbUGzJIZew32hAFkPnNVhE9MqWiOw47" + + "zozjty6kNk1N83UI0ZAZmzwzHu5NUqQyQow0vktdqtUDtNuQOWVDBrlBzZMzs4tf" + + "bbgLjvOVlw1POknTok9nX1y1i108eGb3lqIbyXdFm5ZQ1N1rdRtQsbwYcJmHBeXW" + + "2qMDeacg55NcqOxlx5mVneeFYjRYeJ0ckbFCkO9HPGh6Uz0YirAec3cAaT2SN9TI" + + "dhI4eu6xRjeuwlnHtcd9I6I7mnNQujxohaKtvuAQd6d17CIoMjnTcYTJ0gzDnLog" + + "y87zLa4RIWrjb3QJV4OaRG3hmhxMjBaozkkzdTcUbRtJzGncsju30dDubirvs7xZ" + + "JuXdqYd7zsWQFdt5eUcWbvOEb3hdO1zObnI7UeWd7m7t8zw5eWdMmpq9lvkl1O2s" + + "33XNPfK3sTSyZwcbL7OVx6ZFd7y47nYjGcfOl5WUbFK6jGO85fdlu+Oj//MUFZJl" + + "NZf1tARwa8BV+AQDgQB3/wP+ffir////pgsXwAAAAAAAAAAAADkAFvAB9CgCqKvh" + + "wIIRClJBQGt931KcB7ue29fOM4xl8OCCgCOsAD4gAMCCqAgigO4wANPNs0ABQWrw" + + "W94D7vhh57CBAWsPbK21bY1p2NSlc29vnvroj5VJCRUilcbPtq+nc7762bq+rYxo" + + "GIRFFTW+199fPB8oqqVSlUqJfA6522q9YIUQr2e0dTolBEUApKpKdxdyiq9PcxXp" + + "pT7XA1zw2DoUqJQtbhzOqiUFUEnrTwsJplFOzKlPLNubxmlvLabHh70vPbs9VSlU" + + "C2aInZnWUtKa6kV06iV7xWDfctwDvZfbVSHSMzex1T1Xu3dbtgdcgV00eRqTtivM" + + "xlkDWp3c5VXc0tLhitmrNiVChF12zldtJ3W27okKoCs8t8djvZ9jdAPWi0r3HoNJ" + + "bs1XKl3dVs7jAPbHmZ03gFeUl02d2aYcR6bmqg6173G4GXhqegQBAgTQSUPUEGEP" + + "UZGTAA1PCCSJVT9owqPVMeqfiQAIxGJkYAEmkSIQjRRphCT1GTygAPU9TTTEACT1" + + "SkiFPIj1MSaNAAAAAAAApSICIoiTMqepgUaeyoaaAaMgBiBUSIIIgRoEJkmqaek2" + + "po0BkZAPU+d9mfOtn2399/UaZITRTREBAJMILEUSZiSKkYAEmGm0IokQKAYlDGAS" + + "ykCCmWJBQBpkaKQLBIiZhJpSzJEhDTRCEkUETEKMxQRSIxiaGQREwxpZEg0KYgAa" + + "EkAGJGE0ilIIhQZFLKTCMSQMkBYoRIUkFIkmkQMZhGYyJkQwIUUkTQwJslEQk0IA" + + "pAEEkJCIRQLAGUhJM0NCzNDKbFlk0QYEaSCihZRNABJhCZRFKJFkxIKRmDJEZZSi" + + "mhJRNkEjGUIIIGFMpgaQMaSRjJEYTCYoGlEQpmzGZLISlRlCGEIIyYMaZKkpiCNI" + + "jIURTTTGkmkaGUWKRNiEM1ERkZEjIyMxIQJRjBkKTBJiUyzM0BhkLMYkJEwQBQGh" + + "pGWTRjKIE0SYCUjDSIhmGkyEZlMZjCAYYkpimEBMZlEghCUskyWQyUZiGYJlEmSz" + + "MmKRiQMLMxTTBlJoiJphJImIigzIpSYzFIo2MUASSpKIRJiaBiFAGGmgIUlEgSMm" + + "BGIZqYzQIwIpIljMJIKSZE0FmAxg2IjIaNLAaEhIsCyTEgyGYokNMEzTMUiNiMNg" + + "jRMMYSSQQhMghBgAGCEoEY0SkZlCiRhRQSiZEQgKMGQFIkkGIySy0CZQEqIshpMx" + + "jGSUUKGSQogUJJAMg0YhCooUJTKEgJoUopZCiYLEUsIkGESLIajJokJjEQJgDSli" + + "QhGIaADEBsWJJAYmkoDQjIJNCNGUEwGZIEkqYjAsbMbGjBAZkgkBKRjQGUQQTKZg" + + "ymhiQIhECNhhmMyEMgjBMYCJTZBEhSMpk0zGlEyZSjGFFRQpIykkjFCoJoxhpIQS" + + "JoRZIZMRmiLJEMwSJgibCaJghRAEyggkQySTISQBSIJJMyjWKAQSQKQYKLDSDRFg" + + "gaYDJhkRBqJiSBkSyBmQJhFNBESMWJkmpEwkjEQxQomI0wJiRijNKCQQNNhaYhlk" + + "whhLKEYJKExEESAzLCSURhIAQIJEpiQklAmZ/txdd3XdcOzl3Oc4ca53bsdc53c7" + + "k7runOugoiVLVlto221GpSpUtitttttEqtCirbVttrWLW0VsraQEkhMxSAMkmAyS" + + "CjDSRDJCCJBly6RMJSkkEJIMhCAo0wEkgYIkQzrd2YCBRMZSmJTCjKhmJIEiTDJM" + + "0SUsIxIEkkRTRMyEhJCSBIBsKBMmAohgwmJIkkCQaYkkCGSJkxCMCTruhzdNjaVq" + + "NGI1qqn/H/D+f92/9N7/nf+x/T/BM7+j/3Df5s4H91tC/+oosD+/gYNHpnVNy5J2" + + "alEaZU/66SB3/PXf/7//et/nu+/f9KKr9VSKdhIptIjKzARQZZiqimGUFLMlVWMj" + + "MSUU2oif8IKKYIhlVIpkBgFFMIYCimSU/8VUimSiVoFFMUof/mCin/KqkU/1/2/7" + + "ipn+uSn/P/jZ/qZLjiqHKWmltwNK6udN0mKLpTbnFbHSxf6h/6WePKShwUl1VbdK" + + "GyqU5ooa/vt32BeA5cSpdlPaWguWZVUxZht422i4WJpNsWzjjnNrttYxBLESWBXA" + + "to5UMFuThmsrEMqjbDpYOmG3M9440VM3kpxzZ0ZLjiqHSXODDEyJisUWWKaaZVEW" + + "drHTWsbg1ZFVRmRGCMFFhITKNXhUhsLAnAXFVTa2xYZviazvp7z20VOkudsVqq3j" + + "OeGtvWOVhDnvvuoOynI6VhVKbaPHLclddm+VRwsd9tpyhwG6KG0tNMuNM0w1YZC1" + + "SUMAuLhnLQOupddA65UOXPDKoZRXMpLJUsrlyDY2utozHDrg6uimKZS0WgtDKos4" + + "KnPMppbMLnNIaySc5TMHGbaxTuqd6qpHacO527Xh33/xUTIdWeKTmjbsg0PYKnmC" + + "1lVSd88uqKGOW10E52BMkmKtkyldBFsScY1nFJZktZQvRzSd5S0O9PG43nhMOVRs" + + "OXHDbwU5iQ1kkWZEeZGOqNqS6xHOJZZIhTExGkq6rcObBbGrBOaqc8OmmJTzI751" + + "Vi7Tx0LbY0JUgoOEmzhjjnptxIKus546uBtXLO4JkyYP+eAcAAHOD6fr9j9V+RH2" + + "S/L/QXTV3dz8SL/T8qH5noZQLPqGwlvR6dhx2TVtfs9W4cn6VF1Rfst5hq6EbM2q" + + "dokF7YlT+AevC278qkbLKawmh4pJzRaPv9leNe26uHhSuwBuLK+a3xCu7uCt8ICc" + + "hqAubTDuymwW6zBsaun77TDCZizuwBP7lwSttmpSykZaG/3IVw50MThjdLpDuH0k" + + "DTDN0e2mvqqKkAmVy9EDwysGysaREKB2NormNHUwj0vgO6IiGsJpEuyQETJyWsUL" + + "zZWvlFrieCawpUQgzlKTRwiZJXKyzbD3ulpxiGZ3uqqknBCteytK6wxraGufXo4j" + + "6Ql84X68MHo9PTm7GxF43W97OVuPemu2nSInel9rnXmRB4ZmN2FaIWPHWBY1gskI" + + "XduCgbTFmxaE5YSihkBIUBZk43EhJxOAqFTkTEgZg/58BOXSVo8zbqfJfApfLFzo" + + "w/f/d25jXyxD+I/OeU0dcx/x/aRkaa7TXU9oVlOfGYMm7+LW4ifNnrp1XifHFxMu" + + "5IbmiCprTZzImVSR0Qa8znKbkRuKQuyr1cokqPHOIDMit4yc4kkbdortTU60qgIp" + + "BnSrVsKMeuZ4NPFFXo3ratpwLFLGtrbRUbc6dxjlHMt30iALUHtqu5g6R2+W8fwX" + + "w/9tjnDISkwpFIFITGooZI4IpEG2wm2m2Gk22+NttNFNpstJJJJL4r7Fo9BaHfpy" + + "dVdT9v6/JXtG67C17waENSlYvNK2F2WomFGFDQgRHIUKMGMIWE4Qp1LPYVOJ3ajX" + + "ij0R2SiUikUutMpXscLDown53VRa5NdNBc3ojNNaETWjiHFD0SSCCSSSCDKT2PSI" + + "aiwTiy0mbTO6iKbZNVIZ/GZuWsmDvZ2jyAcoTPVEi8HyYNj0fsH+BpVN61a8JAiY" + + "SJvPsFnwgTI1HXbhbNF1FnpCTeho7rSi2EUjT83q/Cmc4nETmio0AIuw3CbLSbKx" + + "plU6HxSnZ2X76jMxwG6zEfg/GT47sv4GvUeZiImjSpzqWhp1koVUQmYgZfQYMrIw" + + "zgqXzPClmVSyPgXckhxZXzdVcKyu4Qi0aa7hpB4IJs6THDITGdymCiiMCFZjbbD1" + + "Zs2RDWNrUlQ/P8x6SH7v7Pz/8fq/1tn9U3lWuTf1JnUUMBZ0zXwlfGtzjVdDGdNw" + + "/Wb/TcYvZhOV0yvddt9942XK1inv3hKPY1yG22ftVJYGIHecMa1WHrVRdWNFu82a" + + "cxAgPKsqap3SvCX1k9lfXPem9N6bX0uaUbPfM+K4StqpjulMkJsnYV74vTdMY1Ed" + + "oFSIZ4/h6sOvXBROO5iA46Ydg4cPQkTnMmYnMTmTOZL0JQOVaKsWLsGxYqhdCCQM" + + "UGxBBBEJ7+U3578j0euaooSZ6QPtSOwWKBXnFoZlecqTfq1/RtQ4OItiMpbHqNXS" + + "LBpu9xQ9UiKIOt8lmoPPrrV81xoI5KWxvXhM3vY8pR7qqK4YLstYwxOVYstg0KRO" + + "i1fLX6rgTrxlmqlbrkE9LEGeIed9k26rGnWed6Nh06p11O87aBEwmLoD3HcEEAkE" + + "GRBBBBBEkFZVQUUkTHdrccRvm2/fthj1pS2KWAbKGFox0dOmXvOlr51nWKGJum43" + + "BBBIJBq/KsYn0ippp9W01W5ZRjbTSfDNkM7isVOp5Wk82WrJNLTsbRZZzsMYDiQS" + + "QQGRB573Pe988yZmZmaB0HgHcz7ZHJKFgkEgyIkiSS9eHnk2SvPDryK1aqqqmtW4" + + "PSycD/w8sflE+v8v83/dyIplqpb1llszKa0Kl8tWXbMGzMy8XWnF0X937o/wO4fq" + + "0+r7tk9qe2FJ6z3CkozLYqzEKiqUFDKGP7kqsHaWq1aDYcCQokp/eU+vt7uZp4fD" + + "vw29FcKUSuratW2rX7I00/UcnqCIfPyP4ftqCVUyNaqZi2P7Lo2/nvtw1Ntxu2Ov" + + "M1cLOMOjTdl/Jw/jqwjhrHX7ljvTS0Ng9YWklWliFUpZUiCjOKclNiKmjWdFMjuo" + + "dSAo96JmslmGgyCeUmmjEtITqi4DqWXTg4318osVuX2Vfa63aYJNvvZpHIUVXXbr" + + "pPMYqxKrXRvoXCGuFnXhSb4SVZtAm6ojtvuIBkdOcqdgEZ6lcZZFN1kPKhJJhRBr" + + "WEQyIWkl1hnFU3uys63k4eJJlSIMlKqoErDI6G4EEUnpZfaOrlixLp9DvOUpB4Ta" + + "n2/ZW/q+fvPhH07t9H4MT16XESiARMKUE/rVVU3KNwDooJ7dlAzgnD7EhScMIYxZ" + + "/mOidHDestpVUIAEgC0t7/m9fLzzvPVb1fK+s+Y+f0Pon6xzJ9vzOD8R9GeLf1T5" + + "3aq222kVRIqwftW1VyfHRO+89MPe5zaktbKQr49+/jZmajwxNu3Zk7fVWkSWG+K2" + + "a1xZlKFOw5BlJpDTgyzEORiGVhmzt4tctufPV1DsnIxdsV3SbUdlXBrTgwnt41HJ" + + "0263X9faPss1y+iNSMUfp/X6ff7/6/TW98cccp1bYjhzq/3uXPJj5bT8/7W+nhNo" + + "/69v1+jGyfY/aaf9UV6T6SQPl1Bq30rH6H4yV69J/bdqqKoSHon4AEpmUtPAez+t" + + "92Y5lOj2CJ7CYdkZxf0D3R/XfsuFMS/C43Nv5T9sfMZV4L/G9pvd03/3mq9yzlm2" + + "xVJVkOV0LvETLzsJRx4cqu6dXdXXuPQcCHb7ePRk7He904sDcwdra7Nt9q7VFY9l" + + "7jUQJW14xnuJPn7/TMw/3fPn4+Pj6o/Cx3cXKtqlrD9PRbmYZme3mP9E/y7G36I/" + + "LH+Z9Pht8Afun7v7tJGbXiaeU0eH+Gn5fst6/K+NqmUrWijbu3DZSH3hD6nZ+o9S" + + "qiIxVVjIQnk5/AzMrhcclKH4STg5bfDDGO33aTpJ0rlQeHwTE4GVRAlhOxMpdgNv" + + "3ajAlCIVM6Qe6uKg9yOwUV9eRvl2dAWQKng+meXZoWhDqzCyCFDwHzqlW653rPFy" + + "aXH00S9/SI7ZIaPaDOu/U2err6Wt0/RGxFCJ/FfXywJ+Z0NuUscckrzN2LlS+4To" + + "ymv403aBj+06Tl0T6Xne5mhKZXrsbvOuKiXR7e6HiOm9CknWsik7Lmvsvrn08oTa" + + "aD3VS6R5uebW2codGHht9KN5dWRYyrvSKCuOIvhyuzboi48y0eX0b1ZEk7XR2mzQ" + + "lIxgob6yp54pmGTlmwZ30l56vdry8vuvXD4hdHdkDKTAhgiUo5KUmzxNmilIqOOR" + + "j4IT356J9N4UeHHbOSSOyBPJ7lSGRJEjG2PX7P+mxdE4E9kZhSbrNHt+LR6oxuXC" + + "xtS3UxPlEzA5XpdlqQj4iqskZZ3pmdTpI2hJsTma3b8RF/EoYxU2m5oFB5TT0rss" + + "2w8zlr3Bw9jYwgtNtPCzmmpqJwmZzfsew9o+/u+NCiXjuaEvhdu9cDRPzPZbreMo" + + "pkxCrlWTi29L4pZEMIlfLbK+xSL0Zqy7IjaLss0ZGYsGcMGrgagM+zilXFMbIldU" + + "QarxUPisyxhSqeew68PlX96+Vn81ovsttNN7r2tOwJnj1OGZ6GmypFEL/OURjEXj" + + "xamLJXj4pVTillprNqvk5OqCY8vVrvLm3qoKGDgxzLgEkqry6tOg257kmNzyTdlj" + + "Q8tAmWAyU3697unetmwupGywUXVcTN9MqL1479u2I2tsRZbvyj68/LNRM01plhvS" + + "bN5NcjrrccL8Htyj+BCrHefe9PVPN5zrUH+1Pb6rXdo22uWWd/EfwZZbUr34gOaZ" + + "1MdLqLC9RP7u6RSO3a3RxXP8X0wBLkn9FRxLMv9CJEbYsiOpgpUSoa5GSlIQU0ym" + + "1JJSRLorCY+OqjQVlihaqBciZcOS7lgmERMS0iZQTN2xVFERDdrxbKJtzCzbbXC5" + + "bTm3j1zMs1uqI3AHShpYzQRbTYKYrZRILVpDLWCCHKKFK04Pz6l9+B8QwVBx3HZ3" + + "pHj9L3wPqk8LV2RT9q1kZcelVkMztswvhMxRjp826SggOKFASfzLUZH+Trbl452C" + + "rv71T9Wht51YV3hXG4QPJdqV3uZz13mwrzVZnjVLbVn+YVe62EzchMqtzShLkKPE" + + "dMnTiMTvOqRJbzVhxDI1dd1rQhiTqmcLOhwiEgTPFVyLB/BYxVVJ0qTbe0X+E2NJ" + + "5FQil9Im2yK4hAhROqTbaIFD7Kzyqk3ny25Hm6dGXKvdrsl+j9LTNJyMbczUREDG" + + "XgVzlti/gxxcK9lmrQmuXy00nPZ1ZnYMCOztzV44ehTr4++n1Tt21RvA1/+natOd" + + "+etlwD45o3FOGbqiF43Vsp2VA9kWCP6ERX78Jds3aZdJHuSiVaYad/n73gTnNOq8" + + "bUvQV1ck9/tFEv8o/X7P+1ZhaugDmvV+7UkaQ/vHB7fX5WVgRokFFMNzV0S7rpL5" + + "fPt5HpdvXdsa8XNCJ3dO64RjAXp5PJc5siQE7p10k7q5MlxQkHbwYYb37js+uXMr" + + "XQD53nebkY+JEQ3Kr6j5LcbHtxRKez7rjvN74ZI/binYF32Tatmu8Be6TXLsrqtU" + + "SyjpPtDkefbc/yap8EMZR59eNbE1KJt1yzjkr8IrBj8d5+WZHW1FCToyAsXOUEXr" + + "Wtq1r5tZb+GoluBz2+U8FT3va2RkKc6WR3ZeNn4iq1okKrUThD2MqptNGqiTJ4M2" + + "f9u45+/nwFAQyTz4I8lDKWkdQxJJEruEVFU6mHlMh/SyVffytduOEYY+qcVewuWR" + + "7sCx2jKWaQSEq05Vh2otTsmLP8nxVuGAJlL6CQ0fXzP22Mn0O/dc+RzxqdnXq/N3" + + "KIZUKGEwHCFgyKwJcqXSyY9+KkWLMIVwWZW84+AK/Bz5wnaLI44LmU90x/EkyBYo" + + "YS1EJA9jWfE+/5tRUV1ipCoof2zsjgKQ8vpHUIwQU4hNNSOW4tYulfaqfz6P4wYH" + + "GDM4DID3+NqN1ONUA/PfuPMRXS88tk7zKq/wt5RmaVy9WAxsjPw3pHVUomq01Y27" + + "q1V1m7Yd2KfWl+O5Zq7729d9zZ0l0p3fEcrJ5YgfbvWje7O3f3xZrowIWRkq4O+T" + + "FRyxJpiWo4lFPH3WrGdl4cvrRgQWOs7e+Rm7Fg5SGPs7K8wII3++tGhUMYuglST7" + + "5KtdoyntNOHVVlYkvFyJtG6k2rcPNYnRazDvM0jtv9e0GxHtPw9lbsVHo999iMnW" + + "ySQyREBBJkSLp6BsnvG/p9faVUKlPzdQ/ZVIRVFqLwVZA3bCzzChJo/VG3vBX5SF" + + "rWK1RZmzbONI5WDQJSoSvFrWQPYWLVWpk4wJi851alamk1f8QZvBepyqUITCUW1M" + + "PO3E+bYpbGJWorqrG+spHFPy6ovW+piPxPDpvMK9cLBMXT02D897907tO7q6Tqpw" + + "mu19VLVj5w68m9aLxrh5pRd60Z1Y7OPlnWyT67h8VWsGO4nUUKiC8Pu5yxhCT898" + + "xuvPfY+fhoRK5T5qvf5+ore9q8fDLTyk2u/mia2vXGhbTXwjpwro94vOKUYpdrNK" + + "/ilIKJN59XedxQPPGvYqUmlTpq88kgneW7DHmiG23HMo7Zsh04+H7xMdo7xOJJtY" + + "eizcYZdt7XbKVK6OL4vQLe/M+3jq86SgU5889oFKfPVuxF3wlFrkIun9efjz79d+" + + "wYeN/C+u3m1rd0jFGq9X89KmLLXN2C5Po/veZd64ndf3MKIxsceKwWTeL7MD3i1L" + + "FVj6xz2pzr8QKCFNCFKpIp+xTH6JnyBsNsPitQloYgqd1l5g4jhq6cPDUvHlmwrI" + + "oOhRQkOJcJfIaDs0KhNWaJJhi4g5WXdYcDKbkpiy7o20IRRpRFyOFooQ42GI3+Su" + + "oMuUwozR5RSK47UcIoQsIwhhRiAXHRoVM/c+S9/l9R47JC+j+m/Feaff6jz8TUQc" + + "fBu36cbfXyrsgqiUIyVfLNwCKvgnlBRwKKm+brfbFcOClV8LfTPJElZDw+Yw7n3R" + + "/39I96pWacn74akmCfZk9N7Hnbmfnm+G9N9IIVf233Vjv2K+dmOqXTgm/cpSxjx5" + + "NoTM+aO9xtTisCE1pRXSdT2doOxqKdUb7MQGth/hkgx+xCAlvCV3TRG0Ce6IyQW7" + + "O5ROkRaOiwj2YN2coi/fFuizw675bLOfJnWg2VO7rRIEXexnFH3XUPPfxRcRGzXs" + + "xpAtbS7eu63smcY2W+6RTU1psvDNdHE51pxd+N1FlWJbYbvu4qRoHx0s6pEIRV8N" + + "xbCsclUVRe1t0Tr9/qt689+zMRbOMBXqvBVD8KyFEO9HimPzqLzwaL5e+3ZBPN5Y" + + "7c/Kfp4kQCKdTjmOa/v154+n3TBe7/D3+v6r+/voinkqWoitVotACCo664ufF4Po" + + "3J6cfruz8fcQTLL13Kd1yNXLle7zzhNiNjuuwY3dvT6en4e/3/ffT7fX3eKmQXX0" + + "/wDQj59+yNfHDLb2ngE11HTs1D00z1Rmnx+dfhwbhbzuLp0qd0QHMBspKuzzC3ON" + + "dfyL9+3rQfBoYPjz4zsDVN+WG7vLnXx9Tr2sSvtE8MUa1li7Bpqrgl9mbKWWkUrS" + + "xt51NbR1yPPlQlNbX2vpMO6OipAZVCnOzMdCcdMd8ANNA3fU9nxFkfotXt+qp9oP" + + "k+AQUQa8iUvJUoSVIGwuzKjMpmM+3+Z0JJ9oAjV234RfrNBxtZMos3vCkrhlcmZX" + + "JZqK1aqYUg1pqK4fwfD1WX0eSASEKQ/xP5j5X1rQTbnv3OI8ip3bm/IdSENUwIVV" + + "CBlkpUlnZ2REw9p9/blysnsiOzjy+3xKhFfg6Y9VKDt267q3dT8u8J9NhYJotAkH" + + "UBPU1WdVV2dPq97X2saP9b/I78+d+hJa9dsO8Dq7uuiXBGuVPDdiDl5sgMgCCkTR" + + "ucudbu90qcSryhxzaniH091sPgD3KHqWgJEDwpMCgIuFF5DDtnI77sGMf+eGrB8U" + + "CUkTW1qLEWR7RSwstGmUIlsNwAQgEqgykQQLO1knr6u1ttq21Hb6I+XSd9/RPL0/" + + "pE9I8J/gr8OkY248frxb8ffHG2a4zitLxY9lPyn2k/bD85+59xlp+/KfS6jzTDGV" + + "KlCSXUKDuGBA2GxzjS7K6hA7uoAgSlLYS2qL/6jhPn+y2y2u3o2Tt0/s8v7+lrl/" + + "tPT9O/Fvbfdk0V+HtoX6P4/h5fh/Zzr65P+z5dyH9HPb4K1fuqT5PuQMhcP2210T" + + "TD6Tx8InpqHwj333mVmPK+Lfw/Zy/VOHTmPh/Y4e230Y6cunLw2flSdvb90NP4n7" + + "P7x+yfRP3enyjwH7P7Pb7p+s+0w6WTLFVJtJ7fRw+3jh93hw0r/PVq20NKhwUT+m" + + "nppNp/lXTSUy24lK/p9p+x+7bhT5Y/39es1H9J9h/LTt/Ha6djhODEY0qtFflRyn" + + "0FY5fsE/Dp0+HL/Lb9lnh6YcP0Ym32Y/Rwp+H3k/Kf3z7vTy8I+K+yj22wqny+Ps" + + "dv3/tbwj0m1dOmO2g8Kfo4emjSqXi3tw+KtNzhy7Y8PwY/U/sn9o/l8PSD+utZcW" + + "37Ph7krkPur4qw0fu31nGszW2itKPy7n5Y+v8W+vzZf2Onp4K8qjB+bb8v8tOH1H" + + "B8o/l+O9+G0tG1pa21taN/eU7knnyMCjBUlf4T4Nvg4a8W9DpG34af0dOXz/L8Bt" + + "/Lo8d/GXPh9HDFcPhj+ngr92if2dHMPk+xw0x+XptPtbdPTbXxbFcOvGltuZktu3" + + "B29JpHD9/l+75T24fcjp/93tG58fLFy/Nc1mOE2PTw+O7a/KsP1dPKz1Ielp65m3" + + "Lly5mZmOW2qiqrJOg0SUOpO/Ym4AUdn91ovgujOz4FB0MBZWJO4mPoNtb+7266rf" + + "z9zM1txqittGlEv4/jbbCTioBO/q3CKi49u7fnvTo05uxVVX8Y0CiogUNx5JLet3" + + "YPFu7NOEC+62c7AwsFCz2reusG9vMFWax1VlAwU1dUyIEhit6aC7Du7M7VdNstC1" + + "lXlm7XRkSLM0jajTZqNBA9IW4mqEa7U3XwsODHDZVYjuyTqypLVdoZbqcyjdlRjo" + + "dkyjWpGBmkajVWlJ1DzMPPfJIIJJJJPAQDIGiiFDI221bW79r+Dx4685zOUWtrbb" + + "fyOzogfCvL38Olr2TVKbaW0vvu6QF5fnnbMxw4f2Y/dynRyqptyw2Smnj++v21rW" + + "uHL/Sh6afEfd+rg7tq21/aO38mnw4SfDyY9KYm/9rcSPu/X7Jy8DtpVNp/s39X6P" + + "xVjyn28Mf2culqrID0/Z9WNK9+LbXseXB+yp9IezTttsnsw0m2J9HPXrTWa1mZcr" + + "Y5Fj9fX8f16/rtx/W/7ccT29K9P8fS2fRp+r4CerERJEebBr/HVX8Y2yv6ZK4N87" + + "Oc3/UFSf54kQJDPt4hEQISiNsJ19vv6d5ePOXnLnKlVRMqnKJRN8HOc4eHnBzoIH" + + "MpAZ5mOq2Kzf1XTznObSPHfYLFdt2e53f+MGA8zED54z4hfEg7rRJfbXkeq33bpR" + + "ebgJAwUvLQPVZKKFSSDRYI4wwgQCBcqqHmqrcrro/+ISKcn/1pVyxUc+791ve+Gi" + + "7f91U5/UtURLrEFwxif/K7mLJLLBmTJklllMbAuMlEryqfWitYksSyFR0c9WGSW2" + + "NMjKZLbGmSTzVb7Jbba9lttvnPje29ykZaxopllRLYrTpUlc4iY8qqyI5d705MZv" + + "u1ZllGstGZYT7z6Z6plQwqduumGQywMcHwrK86pav3RTHhW18XfjLFYyWbjorjna" + + "TttpVOBUpg27Ou7MrMMyszLdHBzymitUJ4Tz0dVMpiyXRJDbskep0BN7JGO8mdHV" + + "Pd1TStUzfsg4eXuWE9PVt2juEFWDZr24eiXW5DE7KjZzEOuNZG7I2ocWRlLYLVvF" + + "GIucZOLIbpOKjLLUtRat4sjIGnHJoJtX59aGaxoZtSn3kjr/BfvvEueqYoavHjKx" + + "lfTkQc9PwqlPyjh+1Tjaztea0tZo/XVFD512U2EDj9tVTpSLeu7zGstZacdMaS3H" + + "LvcS+9fHUcNsArlVO3L8To+YZW3QdvX46+4ZlyqnDs2vzrkqcOL7lnnrnu8/OY54" + + "O1Vp+VBoMO5sxa7ODUmwnEJvqyTdRq22yZN7KutPTVelXigrJvTW7bYeEeJUxwNk" + + "NlWq21IcSHn3w6MTx68cHTacUEfeN4zPFzT3uFY7X3XTNafe0tNeKqbVU8s+c5mt" + + "7E7erU+HTx2Su+OmvhpwPmcIeHwW7qx29oNMLvh0fHz44pNODegO6ZMEIgYczrCT" + + "WdKk8MDFGSiuOOdBzS1zZzVoqio5kOTtbKzi7aNMZgoHKdbV9Dlq7N0h523x9+6i" + + "49cdHhy5L3Kdee8uTrlo5JI8MkRs0xx3Jy2Vtbxbho8Fzs+RYy555fVjxRvjk17q" + + "u+TeMhUNSCJxOGSaXOJIampROLhmaO2zc6CyY2kbd7PgiY9Mkmm76s3Tx7yp8fnf" + + "E1+NlrW6nhoz1fPXb3ymeTtuRGa89uIgybYSRnch0uU2n5K6nymfCrxsnUc7yc9N" + + "gY+UCpqeMhw3YTjNExOOB6OpwmBt07D27E2yOkgo92SedsjGFb5T4cKHWuV2M8cF" + + "8zMy4FsuJXHLaRIdimuHBprXH3TZTtjDi8eLZ0dKHf427eFdKGF72HenvID6MMOn" + + "bCLWNsgpUEoZZG/vyoPxPnHd+D3Y+H3rpjqclZUisODjFbL69xIOG+QclTpogxxw" + + "qNO9m2ni+V9vD2uz1tpoxtt5t1PjrlVPhy7WwKnZHuC3ruTKRLY2yUlqGlKqWkiW" + + "y9iHnhPZO0rN94N2brW8hut0yR51BrPKXs7JGxb5AnRiZTl2Xq1hpiXy8iczq1p0" + + "4OUvW9g8WPrtcenxbXL58ic8LgbnL1I0m4MeNSM4zVJrWW9uI3DW3tqHzluUwxR9" + + "+s0Vc0hpweORY4VOtNXbALUCyXLqNFcCR7xxw8jTkStO873DPfY017vHfEhE5xAu" + + "lh+U9Pt+W9++O/u05zeb4c7pzjRaWurtlU91y/Pj38bnSo+8PfvF8I5SNJ62aL20" + + "QZtJUXrrTO3rYPXw+NeuFWmevi1C41Gt1m2DMqHmySGsXd4XEMFkBpCUlZSTWAUm" + + "a5gWmZLEQcLCwtjR0rZplkWrZuMqsNpWrMyvBJ5/Gff5lT3FTnKql0x9H4PU/DTX" + + "OxAXime7qULq7DqoaFW7tVaVWymOAghDdEltpIwwyIooHivfPjSHoqKy0NCBIRpB" + + "IGQK8fXhPBpMTMhc4OCJWMuxlIYammJ2sgEEXEs8oDopthFpLOUlVTJVAqKGFoiu" + + "fFmCKtsq1oM33uOW59vV16cDSvt7p7+u80IySXnVy5lF3Mz5ZLDu9ZrDzoUPrekc" + + "9Ie3XnPlekWLviZo7sWzm9WT4r4vmvd4+Mn1zI9eadvv8/FYv0fllb9OdHfmF98c" + + "xiihhSVRBRSemqq32pgz4bzMD6OjNYamHHHp0WsLbYyKxZ3mLD52kY91zW6fPB9d" + + "GObcd2fPPjX0d4du7bA4tvfmSzb6t9NouC2GU+LHHGJNXK4s3xiY6MfbxT4Z83cZ" + + "UuZDLGk0mY/Z/iHrRxSY3S1SG9mvzS+bvxc44Th6JqNHLLC4ZR+p+NfpU+sMTeHg" + + "a67ZI7LO0gsjRa278NqHpyOH+PRsdMcqF5x65vjp0KeJjqR4dknzo+Zsle+oZmSN" + + "f8ttztuTWnh+4V2fpXP02u7ttibExiUsNhbdfPzh1+rQ09U+enFtXS5qQkjjxMd8" + + "MkkY56cYwqZcb6vi222vU9cyYersXMh7cOOI2Y7Viz6BNspac/J9fjp3RQw/gqpU" + + "1kIPpx1mbn6DEJI5wLjKElOj3z3XAvFr+HD+fSn8rhs166dJp1CBw82PeVw26dIv" + + "7MUi/KQbLXXHt4nPh0fSOYs35zI1WtZGrbfqaOvlNp6VywnitCl7G/RjngwTGOXw" + + "v3ThnnFFDb8PHJ2lL1vMzxiXS7Hci9P169PULTtp8MorSZB25VNA4Pw6X609+3Vz" + + "WTVcyRy2dbt8H177mEWSRvh8M+vSerjnx/SZfuZ0beIXSUuzna/Om+czLbbbVfTz" + + "54naAdd+pE26qa+jh4iOkG3g+U1FmjxmGX6Gj40+jLEntyrIn7/D+T8fy1+Pjjup" + + "Bc3CtbNuXO2tRdulIu21ItGsL9ccDt6aEtrxfwXjqcDx58HqqhesQkkFR5Hw5s+Y" + + "95rjxZ49Zxzzzs55zny5Y/Trf42ninShp2tC5MykPXPDq/HSuOcy/Hrg+uXOZjhw" + + "qpi7evQ+G3aueLbIW2pPLBOXPB2k0qeWcvH8dPX3537NGVVjFVhhjKxliVkqkjay" + + "ptqZq2S1WktJVZNtVJa0VtCm2mzbZsiNNZVVSy2ti1tS2Sq3md9hy4638z5PHNMz" + + "Ix3IfMkD8jgU/hevg0z6O9vrhfx2u0pdXi4ooddn1WwLTt3u0dtfx13/DwegMQYQ" + + "wdp85zgwAfA3hJq69eh7Lu7zLGHl5V6eivCu1elHunTwnjRy61p714uThUcOOcz8" + + "O1cqxabWOunLt5Rw9iSJHt3F3y3WWZdtujHhx50iRPHtKachw2vnz8eK369x98Ov" + + "hw2vztQt4JRlnK9QFCycOHEpchMB0Ym5SeIlIUMnPFcafA3klDSwWSTX9VVFP3k/" + + "KQ0+nzF4rj5wtvArh604+dqCN3Qjz0VcqypVmrlXVlSVcqyiSeckRld1JlJlRlJB" + + "zmlk1LS0RqoTfWN3vzzprfXjY+ZUWT9c+ednqsvvSSJCkAXphQSFpCgXIwRJFQeP" + + "HfxpU2Op7pg4ZhX80D8P0HcE+tvtafe0PslS2h6bEUphB+Trt9zcMySlFfrXx8s6" + + "aKGUneDdfjQ99/yYfX7l9meCDI/bvJDJAQgdu6SzNW3eZlBQykZoKrwo37d0TaW2" + + "0DnfHOPJfg278PvnXg+re/l0U+vfj83QmJIyIhDN53JH5Px9XhPr2/DXcY+NzGJO" + + "6t1p8J77+GH2+xfbwXyN7S7ySU8e36ZcY2cmX9ZqJVTbyyJ9LNd2Hy9pFJjOJx48" + + "YJh9fxDDVU7nuPtjdzVxq4025elJxy5kTGLIXu3JDla90qnLmi/u/hOXSqnQu+mf" + + "lpHZt8sRqH7saHSSEQXU251XwY4dOFRt18lS6cUnTgWreu+m18JO/RkmYWb9Oofm" + + "aH1PPXk244ZeFEhws+fI7cknaR6D4fDdfBuITwr5+BweumnDtjA5GjvZpuOHS0si" + + "Djw9vK9vVXw3M4takTts7RicqcARg31RQ03CvXwCPOWh+DxPrrPL04oI3S1HWXPL" + + "V28NsefHEu5KGKEqe8NJPYLCCHQMJCQ7PR5y21rbPLh6zyKm7rpxn60/GG3l6l0b" + + "Mqm2VCL8CsOWG2Qe5VVUemVS2xUlz8FNVTjEzB3gTsxNJ2NL8fkcfOEhUaCuYPW1" + + "wuNRLHrVBHPnUBbfGqqnLbx2unVlEqcfFU674T6+c8eHON8cbcPxnVY79dPSQXrj" + + "j02ctOXInljHDTacJEg5ZB5GNDvHrWNOquSOU5GHgGIrXB8Q3PTh49XFuZnMke3D" + + "Pi349tnTc2x78ZbabfvzMff1Q00qpoqlPdKqaqUObw73hT5rm2u3Djb92qrt3QRw" + + "acoV3xS8qpNypaaM8CBy9599F75+N8/OM7xre29w+OXpOnjtyeGSEgrypPNCAvLz" + + "gjvv0nE4N8L06x27SNPjUeRJEjXk3zlzOGsVtiMq9O5Hkcp2VPh8K+XJ7XZx9Zvt" + + "531nPHGb550jpsrvKpnZ7X182tPp4nB2m23Dj50a+PuHwWvHvJzCvWfD1elNOsfN" + + "SEgw75bTbwkkc52410eGuLbzmZkZvvVmtPrz195lSMXTdO+GvWa25VN0UMpetNG+" + + "NwU07IY+Tmk5PCX1drtxw6VwlEnsyq9FxYhCRtIhPTOT09a7ZutZpiLA6pDtYY3V" + + "5igfFU4zU4brTy7ejat64Qejh0SJHTSTZ3u3h212EB3mgeekTleTDmSOOVnfrh6P" + + "Y8ntJJ7Pr2KTqnMOYbga2JznETGW1bGqmrY4zLwt8niQD18xElWURb94FyqjnAZ3" + + "z6YJ1iOcC2nMPuqLNVQhSiLLqoyCroXV+YwVxq9cddcOZJtS0iqScZGJbLQOBQXO" + + "HE9q+9mbo5znrM8crxzyCVKhGIK9qoKpR4L0FF29epznKxmhKoosQGVDU2h3Ay47" + + "SFIJE+nw88FX5l03vzu+JfbrzePF0kBSZvDVsr5KaIWZmJzqUoIpQrMhASe/z86c" + + "6HyL3ZqezLvn2w0+aVZ7vTMRFUZPLRe7Rk+Uox4XrFfp8/Xz18+/jybiRw7VvURT" + + "5MeVT3Td4+Ma5xHFTVt3xxqcror7cx5cZbWPo78+Fcp3j1jCSRIxTy4+XByxM192" + + "To8aO6enDlp8Tpwnp5LwvE56l2zffqYlRPPQ4gQywiSLYYacvPXtw/DHocyrt2j0" + + "e/enNm57m0qsB8YrRH1Lrhwgi85HTIViqnpHjX5odbWnqdJNpywNzy5F55CTpz3b" + + "Offvji3GWujD788zPCvnTt/r5SH4mbMvVznmrtcufVxUd3tFD8H+XCVA9+aArHR5" + + "t2MPNpfFspyylwe0mEjs5oJOvfjxfnnNXNbdJPJ5YcaYgXzEbNNe/DNpS95PXWbX" + + "Lj5me++lriwkeI4ck6bca2nHauuzfPTyrxRXIm23TPacNjajfNUa97T754q3c0rP" + + "IE5Nere/DaZzyBPTHL667M6YMUiwUw84c4W+5rlfVR6zxCzaeKly9x9x6DhaooPI" + + "1CNpPHVtq129Z3bpzpOM14nhw8c8mvgVGdYiu3n1jtni6FPTxEt8uOLVAnqxzGvU" + + "4XXlc09EDkrS68VHEuLovfh0kKjn16nx2624KnuSnHXYVkIprh8uKrXkxp5Z3aqc" + + "aeE59GkSJ0a8drt6aX+06Y9W1WYqdPi+di9Pw6evm8zGnrTzvvv+GSuG79/XDiov" + + "H0qepaxPYPTbhXBj1xR4w6Tg6NcOybV4+Om+3X41ItLvfGlU341TWO2R7tSuZO+O" + + "3asyajzIENvnh5J4Xw8OuDlfBN8GUCx4420ZVU52z250coXTppy6fELl7Rjpy+nP" + + "x28cG3ng7sNCRkisEe3Ltzt62dtbszTgXpLw27ePvRw+vlFcKR0ekbTaMSHDJB5e" + + "nZ8vLbTt78dG25fCwkJ//etW1scxPdFsVVsi0tFqS177RsuXJMklSkhrEjSwORa5" + + "3WlxTnZfjFJJ8qqYtJkGIYaQX+CRXd/3dKH8uAJ8Y9cu+OcSSPAL6Gs336Z468Zz" + + "vNxQRIyXt3dm7s0SAwKIJ5wEk8AwcCHFznBwg8o1kzNO72t3vAPY+sfngZ9dFb0o" + + "+X4H6XmWneYezTTiKIZ4CUUD4QEQCdPGmwTwkyTaXmJ2d+i8PAPAvDjERepd2Z2U" + + "tFeZqfopOh7VAjAeQ8BPpenxxACAkEQhEExObQ9XlR+e37Iw1mN+ICD34z4TEzKK" + + "dyQ5oUQnsRgHH1l1ker09IZ4KIqyrFUOLmqZbKLYUGaGAgOcGgdbwVvRho1lbYNU" + + "cdPj1zU4ogY7l1TxfNNPT+zP92ta1Xu6TpY6QeISM9/hrny59kjOErh+Ht2BPj57" + + "6L5BzgoCDQAx6HNqd9+Dyvbt27Lq3osAuFDt/Zv5zu78vxMXPz5rDDqp1z+Pi2nh" + + "zxuQkFAnqvWm2HD09db9dvJvpZ775mY/Nd5n5du34vVU6F+N+jTb5SesToqJfaen" + + "DXwdO+bu81I8knny2dLk+lPtFD493Hx70x8+ZnD/LrkygIFr4AcZGrTDQcMwVWSB" + + "UIKC4cStoBZZEzt+9tptwYhbUixKXVLSo3XvhOmipnoTQ+XBJCdfHJ8r47yZmPlN" + + "tp88W+HnzreZnj2dX2cPfT3zCQm3ifI8tvCeDfBNnl0nnzDynndrPNObjUhIM70k" + + "+Phvzu5niebfbE8NY1HHuJBzqbt41px6TjT2wnuOfnskTlZwenlVTqj+HnLFtEu3" + + "oQOnRi96VHqH1D1c+g/IZ9nQp1cZlfv1606UPjEUVw/C6dh+Pz4Dro+bIdOl2OTP" + + "vLTZ5+7/XSX29Bv0PSCdHY28GJ5eY3ddXvTet3d8H187Yn31vrt8fNKu1D4+cOuX" + + "InT13p65ql8fJv74217Pm/vXbqk3NtnkqrqnTkK7wpfdhA+r975xmcNIp7Twznji" + + "evTlp74w9peduGxXiNdczaymNYnPSSSSFdH57db5cA+GzcQeEkOBjPVentzlrtHQ" + + "fBtWJ18UIb3yjguww+BUcg8J5eHbljZU09Ja1euOjrmjp59ooZ2hzKN2Qay4mLA1" + + "pTOLMipVkiB0k7w4rISoDm5vGxYTTI8ymFxmtm+OGuNY5ZPbcqyxJP8qLkqcrsuN" + + "XvVCjgr1Q3zy6o5T0ZznGJlVeY1Td52qu2m5V2aq1GXbu10ddY3rOrpy0u3G0gaI" + + "oCqoGaZwMADnKp1up7vrdzvSOe91CCUrW9pWJcngyfSVtIngw8zxCUFzpAJs+tb5" + + "Zsn1j4Dp7628zYe6Rgm2wa9FYc1vkPNMB5NQ8Ic3l160dXv1c6zek8W9yRs1O1TS" + + "z1rN1EhwklOMD2NGX6ryTXTqgq+B6Y+TGD0AgzsO3XvudNp0bcBy7fASeOUcunRo" + + "167Ew2GNnFZG/O7eEsenI5SHrvvWZ2addPjD+TtfXdODuwvq5huPLaODCtE0ntOn" + + "L4e8t7dJ5M07bNC1FSRtpsdzzppPfI7dxw1640x8bjJekxsa5Y8VNtjEcBtCWwcl" + + "ZTbCJcD8HrfbHN5KHTo4Fp819fe92ONY4erddMSl2w76PG6tcHtZwrlPXKVGjFac" + + "1j+rOTbp5jOXJwuP10ofsoU9Td33dv3n1t2cqdfj9Pvyqk2efPmZ48XTl0KlODvM" + + "5h0nx+MfdEOnxtt86WaVU/eucz4+eu3ZVKY+v3r850xVTdadrjormihyN/evHXTl" + + "OFR1cY65NTCcRp8FenYLLIlUW8sJOnpScPWt7tZIJtsSOmHB33atvt8eF2+HHiQg" + + "NCRxrt5ejjpt8Lh0U4HvntHLtejv64WuYovx4cvjudsIfUUV5bOXl6xXKF8KXjpP" + + "vQ+fOmXao1fF8OImWnu/i1atr4deV54zS60z0kRUkUeKm8HijJ0r4pFq7Fh+ZW0p" + + "aNBfXr10NlfrR0278/Td06Kxn1/HSm+H8Kqdssebvr9V00fgPx9owrAzk/h42KL1" + + "67fvfB4VPiUIfGBcH0P4etPoVyKa5fXxT68OOsAuVItPWj1w165dPPO3Prp1euH7" + + "9fds6coXoqU5gR9Lj1cVXDfOfUFnHKJcn73553ve94fphI76boE5x5eZtBy+Ht3z" + + "2NsO2PGCnbwrDt+Pq4KodNhA28Ozw9e3Tlac0vVRrljGXXjK74Z2eHlKbXHRrpJ2" + + "M2gxJI5S8WzbWJB5fOzzK0ngIDK6THQVqb+66e221x72x9UW+rxDexdJ8d+/O9Zr" + + "M1mXw8jyxjie+j29RJENvabZofCnhWL1wD3ljj4BcQ54OO0GkHSQe/IN7t4HfjuD" + + "tPHLp3KlkOazq8sUy9Y3tjOLJlCzMmaWi4d78Kd+VQ0sVjFFisKSwqlNNSpaCyMY" + + "JhUqbN41WLJEmRFsshFLI70wpzxVDVJQOGVDMCz+Yz50FeeCnxee+p0OKhjnr5nP" + + "et8cb4wgYO5ud9c665eXro2ZltpaqQ2VAWc7xIg8F9WbmVmuss1wH46NPSq6o+75" + + "r6ndGvN2auHmEkDx6GEenCEQjUVKH6S7o7nqeTy/VH1TrvmVfi24LBBw8xYwSNpE" + + "8sJnV1c5fbaj7DwBMORMfPLNZvLOcobrd4s2vvkgcp4VXw0SckHZ8PbX4yw2pF80" + + "01SGzT3e1kxTTTd04UOGN4uYNHi8W+3ItR+t5UkOHvho7WGOo9fXnnm5jU28kkcn" + + "h8ar34DKQz8PS+0UNLpvX12vxVVT4FixZRLGVTCKg7d6NpMKY20fHFHbPHAd9cW8" + + "W3B6uvHn1lut71682+3b0eekCcIhIfPBfemlNvtyBHAV/OuTYkcsZ7vxb3PCthAc" + + "J5Tp8ErwsxlI0n3rzjvR4rr5meB17QHbhSBLIyHa1ZzsIKrDw6gTDhlwJiwFxV7C" + + "TiTvjH4uOQLhBYpFs7g9iZz1eObpyecFTp09Ydve/h67KmyAMb5631VNtmzEgiaH" + + "voEEA9jOcHBB6Y5jttTflN4ntsbyJB2kkiqnekzu324+Oz6u+mggPLyZ359BJ5B0" + + "H75vv+O98cccbcv12976z0kU9dPnSF745HyYQ33cpPXoOXLOhUp0DfHblUbbed8u" + + "lr64ejy5Ydw69Z2I9N+ed8a3ve9zh58tTm3kTpI2VpN8Mb84XPTbiYlSnHxsVKd7" + + "5NOQ9jvhPHro9jznCFWeydPNaNzME08nR6LWss1Ouel7em2Jvht075zNukuFDuk1" + + "adIWgfePGTgVKdrr4ziPTO8PPDtjuAh51atsnp486Ws04OcX3GrzMsVSx9Po989d" + + "4u9uULJywb+G3r10Y9F054GPrm4+L04ZJJkqxvxw8zVtr078cZmaVPNF8eWOnzjt" + + "m+Dzp6MOXKqbXT5aKmzzblVTg1w8Fy8+g7bfFrpVSnXPW1fHbb1XDGGpmJERNfAa" + + "YbUdLIY1MzGDJvWaVJua1NSM8i0YiLdVbblrW5bVtO8YJSMqFKEhgmDmWUhjLJDM" + + "DKMoiZY0CluHGm7ksuQolpmExItaAGFEt1JhFAmUBNrbKCiJTAyJZtArEMXRREHC" + + "ZTHBRGRExxlmSkstEbmFe7IABXoWWFGHTOoGks2lkVQKlwsertIkulaYxU1YkYar" + + "IugRakIpIA20qUYZmFcabhmNazfPjwNMIdbaUG3czeq/mv+/sp9452V9fRjeX3nA" + + "+uetKRd6dGlzfHRVjgAwXV1frY5IFJFDJHyc4IKXOHll1l7lpW8epW5ML2nMCWfF" + + "zdoNoJaHyyw0D1bEtW98yTVcnh6l4fNM870OjJT1pY+N9aOlHSOoPVAjvfOy6XY2" + + "YjllLzgBwOAG54zy9JMd5d5Q8hgek7RpQ8GnkrxxqqbKdNcHfWnS55Ncmdbrjhq8" + + "o7ZUGlvWBfCumh2vHI1+9s962fXxMfAcquYF86TrDOPl1vW8b/pXKecTuBeH0U+L" + + "2fGp45XJw718Z9c+sP5PnLvB4ymlt2KlHLXaTto+Lz741xvN7za4jqJInjts1qe5" + + "S8qL8mlDH49Q5+dZrXjzpsqcd5m9LldKpvtv4EDZ8DPrN/Putb32490+paWvg7pO" + + "vrlKWmnnI72+pedYn31Y0duGm3a9uBOGOHp0h1SV29OedcZxres3mbt32npptw7E" + + "xetpdUUOnblLt5m2eaqlyh4KfAeqHL66aztyzHfh69Zol/TfR5kRkieuPNq2+3lo" + + "JODHljhPalUp+OsY+bVGsXp3+KNK9OtuXLOAJqZoZPU24tuyRwnGurXKohrzvvvN" + + "a1ts2nXKnipqQDwxOu8bJI6ZfCCZCNw6XfbiBozK29Oz5zmLqvm1x9cipT7Klty8" + + "pOF329uON9fPvbr1pzeMpPe+Hr3sIHq4+uc3mZ3PLvZO09OHTzESDs426htwdn3f" + + "VRW3ZttTnnnM+rHbw7G+GlU7XPMqrzx1qcbOsdvGePMYn1vf33e97bkXTF7M1573" + + "x3nTpy0frx3VKHxzqqHTh4ED3htxzp0rR7w7XpnFbjBaMsMAti2WdMGWWphmA3IG" + + "ILJKMBLTKBQMAVWSsjIorJMWW8bZqzbphIxqPLNyrUqhpj+j5VOekvjvVUYBwAAa" + + "KM8rSbnby5mMvMGZKspWru7uiVau7t3V3cu7uqaSIWAE8B4eAc8bruXXY8ta9Ryl" + + "s10jpy+y++675d2EUSCjzzqZO093qYXV3T5vii7tdBPVdZIj3ygmbS4u+tw9U5gd" + + "efWVrXZ6tawSHPWTXMsxnk4iq+i56tphw8+ToZ4O5ATgW0MkEcLw296lNsfrDk50" + + "J1jPLRV90fWN0hz8XrpcPBenvXi8edeZs4mllq+utW458+TOnpnKJE+E9OPI7Lq6" + + "OG1pjRt3w5fVc9jp+Ncu5Uh7FTth7vi3HHbwktHIvTl5d+3CHhU0LhwySh1NMXTX" + + "faqcvPWZmV6OkmSyxFrWcJrWi1kksrvvgqr6xW9zj1ymeq4dcNajmbSDkR2mTlry" + + "5AnE7fgk9Tk978Fs2pXhPvjltkl3AXoF93yfjrr84+98655556eaKe/TcvX8+tDp" + + "+Pi1RQ8fdUu2pvFdMbdPAQGNN8ivU7S9Ryc166k8yJc5IdVFdb88+uu+/zeZveuG" + + "j1wuL35UllCnrTCt7IYcNxThFFbQtqjNZgXr60baY2hffWp4+ubvM/NIWzW5Uj1D" + + "p8eU+ZTg3naukLoZzl+a1n3vGta8samSFp7nvlKVuVxKevXTjTg2duJ3SfNK066b" + + "lwcPF5xw2+0cZJzrx68c3veNZrGOHXbTSSRwPSDE242fCWz4vTsVKYqOF4bx775p" + + "0xeOddrOpVXqcPaqqOW22WtV88c4xmZY7dL6ei956V67bbVtWu+nzM5fLQ6pS9sJ" + + "RXrzSp0cNSpHqF1oswXg7xoeipTO2OO3gSMFkwqyWwWmzzmd5mSrkIb9W0R4V052" + + "4SQ8m/L07yCFN+NEinDh32PHfHDzfDTYp2pF9vXXneZ84x6vcPRzRtDb1rS9KNoj" + + "G3tt8trVSm4nKzy3R6xxhOMVR5krVhMyjGXOrVEkqjaow3ghlCSpZNWBcVaxL3Fc" + + "Y9ZJpkrnJzlzh3m8wze+XP8uV2KlNuHovYPm99afPmu8VUqUJ47l3jmZl5eHCqbb" + + "HO7xlEBFcBA5Jb3t32Zl9tPvd2smGycKE9uyfDQQPDS8Ltb4qBF9a8qnudmpDwX4" + + "+wdtdWPrzp5ZJ51IafAcnZAsPkypcqpRFBAcxIYWs3vTR50fEtvnqdcUo/dUXwei" + + "bTydGiJ4PFIOWjex8NM77ddunuIT3rfm5Wc23BHly1Kmmj152czh1j2qUpWYqJEq" + + "vL10rcCedpLOreZEjlnPpzu3bt2Pe9pIbbhG5VdskX49R4c9PrbZr3tVMdOn17de" + + "nw+aNedrTuVI+Pjo67O359n1jijiSSJ9jstJAwAWh6D6ObOekTEOeh3nAr2g7ynr" + + "8xXTOMYFcwj5xiIpx8cwczh8LfyjzhSPBt74x6zvdzHlySLo8nCSRsk0eS6TRbxm" + + "Z3wnmxmnHMkNhygxjtJKwkU83mOviqqNjty5d4e44KmUaw855t7i6cPI8nbp5Sqj" + + "jbpFk2djdy3yk88pG+mJSHbOXfhw58IK24kkSC+DzcXXnNW612O4HXcPOwd+O0Fl" + + "8PvuZjsCx5376uzwIG+WIPHLtDGueXTEg7dMzfR0JnnGHYm9idAqLLCyKsqxZVXx" + + "lbdLKpppSUky2SmfGld42pFyh9d+861rCugePr6r6xOggdtdPr4hx457uTlQ/lju" + + "vcrnltjnbtqu9rUk6cL7e+9cX1mt71d5mJrs2PD2zySR16d72kTx67dPB2rKOy76" + + "78XpyWhUp8dXq0t/AX04768zWa18ejz5cuUnls27TZy4O2rxRtxcg11S6cfNoYO+" + + "+madlcs6drb67VY8K3zSk4YqtLvupO/Da6JNXUsg3mJLapKtWFixTMIxiMYqYxW1" + + "DMkpmVKMqXrbSzMt9/sqIqP+t/93+I/0n5Sn7T+QT8zf0X7f+TD+B4CttqUP4hlE" + + "RRRTARIfupD+YUw/Q0KfxO/YVFVv5cOFw/8J24f+hMf6Mf+DF/3MXL//P7Nv+9/D" + + "R8PD7NE/L5Y0/73/Q5TalV9v/fbLbfTY6Wd/hbKsn7vhvhcttfh9p/Rx9F7ThpoO" + + "zo/of+imn7jnrLbavsef4r/UcA+RPuf3Q+f9UqkU/8ap/+MFIjMqlZkqslsVZsrV" + + "JUlRZLa2yy2qaRaWWqRTKzaZooGCAwg+x/nV+FYg+fi2+gz8s/Z89W73ufUfZfMZ" + + "rG5jSeX2+tXiLy5tM25ZFqjVUHVXHVO7t3Rjfk7WWV5Xd3zfCC7d74/Bsvzb8BBp" + + "uu3U3zvXOnzxjyszB3F1Lpzy88Auvjt8OJfX88hg8tvPa23zrze8IBCEkACBACSe" + + "svoy46IiKqqiKiKrmbpczNUAkJJCTVerLbqur773rXpy1c6c7tea+Z7XygAnXQEQ" + + "RJmCo+i1VHsgGMnt6oTG4h52C6u8SvLrMP/waB4Bwc2A8sBaDwhBB/o7aeobMefe" + + "uPi73vZt7rVet2rb0T0fQ/9rykNCbO/hd3LcnNv0nxbJpOOM9dbX3aauDKzP4RVk" + + "8gGChiP3tin+2Ko0zGvv8rm997r3xV1pt67QJwiEFqEG2tbkdFH93DBwDjIPBfPi" + + "1V5aFeIAHWiKoxX7fYcN7XsJzs2YByCqCB9JkFUVQVTA6PRvzz5effmf8/OC9PMp" + + "C+ZtzACFV1K3GMDvG5p00Ri2rRwdRGfGJGZluZmRrhVWSvlPXhbVm0jUeerZfHWX" + + "OyPb4dvG7fq7d2YuV64ePXrvx6mb41zvjnrfDiqrwFcQ9VbJCMKmIWYsyFKsKZAp" + + "mGYZYsykKYZSrJYGZBVZVDChZKsAxJMKFRiFQZVKxBZKLJJhJTbbapSlmzRec3cV" + + "XShD4BDzmq1wkRIYPpUFVy20DjqcYA1wAOHwq+O9r3vWre0sCbAG9xdKyeSrfivb" + + "QO34ZArRrbCmGhJ6LPbla+t+POc5nw7qzbdSzdq7p0eJSUbVXZtq6NOrQouWy7TR" + + "Es2HZNRu1Stu7Ysi26gMq7VS751zzvXPF5506HQJCRi6HLltz9uN8Xm7zDLmXMwz" + + "p7a33LluY0zKuVZCe1T/O/Vl8LrrrqrrpOIUG2dJip/z1f+mv/K98HqwOlWunXPV" + + "64nVSTpZbdoyVil8PHTcq/c4iSP+Kkth+WA/sxSm2JD/tMfEf8rSNT+n1kfxMmZY" + + "y5UmMVMVJ8ZbwcyYSf/ThUxkMMoOz+R2qaP6HTarlv9RaiqxhI8PDkHT+8nW3ZOm" + + "t1jbpR/acHDtXbA6Tww1EzKi2KTySO7N2ZTCkq7jYh702RpxAodJwef/IaXmsXK/" + + "lMbLbeD/FpyuGQfEv6LSrGVZhmSxSSgoikttRbLU9uW0NrwxmKrwfsj9zZ07ekki" + + "Ej2irVcqtMxjTEjVXdf6P9p/KOcsyr/syrMkfUEhI+3yT4fG7atVVren4qxU6V/T" + + "taOFf5Mj/xYPqwPYq8bLlYHT7x9X86t2frOsP+5UnmbJUjANvKTCvZwkj4T2/Xbt" + + "J9f3uJLlxpGGJJwQ+9LUNxUfu/pLKj7vl9RwfBGH822fqJ8ukk8mkR2V7eCdNCih" + + "4rqR/FLZ4nb6xyNCn1IfeRyyRO0OnsT1CDQ+jZX2q4iaXcThcJadGG5K+NMY2w4X" + + "V16pdJLb4bb6ykpDJjVVSiyDx2/Ppatf7fHfqTzbxrUmrdbU+rGg1FD5mI/V8tSf" + + "V8o1D9E2nlH/Sfrsr/yHD/OP4SeoUU/V+sYwlSp/5mPQ/3D64aVkKRGlSewWP9VC" + + "GFgUGZCQwsROn6CqH9BPpvLYlK20kmjUqRVZgh9aaGzdo/4oxbVDFP9/xGOTxP+x" + + "g6H8uhV0ykMME8OXjcocLSqeqxYyhl2P6/5Hp5nNLf8IonRUqUNjY/DbO5llxWJF" + + "SKUSsy3EiYhPJ+cGHd98MzE64M+DAkD4YiKRisRkTDMpmR+sxk9icopWw4WnC1/0" + + "5aVMf79WMpaf9tje5Pm9MTeot7xUVJUoSR1ibG8TG+mE9pDBpFKsllWe3HKtI8x6" + + "SfEmFttpJpEsCWDSlS/NdtwJ44ls8MVRi1bmLU08xzI4bQf8lyf3o/X58cfuZXke" + + "jA9K/Wkv/oCpOX8AoptO3imxpWsWZVKaPlFYOn5ekY1bMWGWYopWjCWGKaLTIGkP" + + "wFSZp1BRTc+o1ds/D/mY0uThaKlVSilOHlj2XFcG5JxLZUjayIhAAACEhJTX703r" + + "bKxG0kYoRihhijZMYwxZWGEbWSBqVDlZMpZTZStskllbfWleql5taVJKGgnkxRrC" + + "VSqptInylG2SrIwx+wwoppFCiU2sGh/NQbbQhTFWSmMltqpy9NIxK+lX6Y+UYTIb" + + "ZDzMDN6G/c8HjdYsVEVWSZxbtU0dN3q1u3bFRfC4kqOpVSPLo0pZSIiQOFnZ0d4q" + + "sQkz4Qqa1DlekfEJApicdLA4a9OMxhyvFegkCmuM2yHU5NScI25iY4U24jHLltts" + + "7StNCk4frJzwu0Y6VjDDFk5RppNKqlRASOcpVq3MyVYiVt25mTCT+oTRDRPR2CKq" + + "KWrVqlUrlqaNSrjDopxKbp6upXldb1PU9s4hJGJA1VbLTiRJ7eok2sM+UHLbthMQ" + + "UFfLLbZVqqyVK+p1Equ3tpthzYl7KWLEMTEq4Ll3YoV5stLbid+m7alklmvcxMyY" + + "aGFGVGL1wYwx7R6xjFy7cn0pouDotHyZkzo/hptTZOkPyO1emWMxhjZLl04IdDYK" + + "mkh1kK4y2TMxcjHDmvtbZMWE+zDHXCnuD8yQLIjg4UlcKxjHr9gopzYxfuda1rEs" + + "eHCK6OCQ6xT4Pju3n5/X9kkiEj6cN+/vl+uaZ5gYN/g5JlAUHSDiUhoOAhwMFMVB" + + "c3DDHMN3DFulS0xrgWmW4W5cMuZhWta1rW21tbbRzrJVtBe+ulvYM/s8dPjcuY66" + + "qqqisgnSPat2gVwbVEysKVgXdk1QJsk8RJCBD2v8tenlrnM3edFeqa8Zu7mq1raU" + + "mEZP6xTGt6zMkdvq9uZwdp7PTR2nSvKidMcnTDZCbRQfLpsjVtrN222z1LI9jbbS" + + "Yde7dtk6DgycBMmW9OTcaTFMfB8NtuYiTvVscobNGKRo6Wb4zDniY3e2mSmsjJQJ" + + "4EQ2vqQkRVGM8qYh3v0q2rPteqmFz2k1KQNMUOrLk2hBsGYs7NRoFGZ5rKHrKVFW" + + "Up3oJ4GS+bM2pvedTh2+z59qcemFaIM+lnMKY/XLM2leOJtTiZEVfbeon1+vwZOB" + + "hQgviaCMyAjYhRqyLmywXa6sJtAjY0ekbBVdHErI5ucHJgQ4jsRIimS+VhHvLz2P" + + "o9PoKp4fLy9uDHljDyKyG7cVtjlTlwPJ2wD56Xk02ttipijbGTs6TRK6R26babRK" + + "3K25I5U6OTolR0fLt24J9HaeVeHM4svhpuNNlYp5eDRNLKaWrGQiqmZbs0Tlo8Bp" + + "tppto4ThGn0cT6OnAeX+R8K25e3KOzaUpVttKUnlUhZWFTasOmERzfpmb6O47lt3" + + "Whna6EmiB7nAKT0eA/sERTa2uhyCini85zJ/DpU/B/+m3fJ/wH9Y9AkiPcclOX2Y" + + "n/g2elK/4y2ikYKwUzMZcuJVFe362bbaGluwykCmE8ysyzLFrmryuvj1Xz/S9/AA" + + "AF15cn4TbNPgsRs7cOFV/dG3g0p+7T5dL60/tdkgpyzk/3v8imkP80cFiv6KUxX9" + + "LGz9Vfy9n0NI+HBMGjFPGRfU20/oK/wT+7+V6CiR4ktktkvJP6O5j9KtpUGP1T4k" + + "kf+7GZWMJ/d/NKP8Ksq/q7hRyh+q/vOT/iN1f/NGJt/f9yWf5H9z+wKWITjGZjP2" + + "GmInSyTkRo2qVStSThT8HxX8MximI2dIqo04dIbQvxbWO2MVGkVTxHSI0R/h0eev" + + "LpWSyT2p9GP8P1y2m2c1q8325VIvE485eDI9AlOHKGBw4JhDiv5HUmnSO00Q40Je" + + "rcSSy5GXLGVUp2n0eDpFE6T4Y/r+er5YqJai+n4MphhmLSwD8QKQoGSRJ/o+6YvW" + + "aSVmfLS2qpnMM9WmHTRzMJxy0qHVaVETOYZ1ScEwOJ9g0NPAmjGk0rStNtsbQ5MG" + + "2BivKYNI9Fvbiqv8b+qqdv6PL9GI+O0lco7fpI4cEi8XLlw2kn5YnpWFTwgTabky" + + "liH7Ax+fy+323r5BIEhez17ddXMxVVQFUOdlCkEiQJigNAR9MV9a+Xx16vk7dzgH" + + "lDoGcCQ74xnfnz3rzzvXO4dlaYNK5NOUkh4fqSweoaJidvSK2eXFtkPPEfCh9Gkm" + + "XRyk9PzmZVzMqjDGleXlHlJE5ZMZSrZt/Vu5MHK/2HZNP2ivmSPQ/6qw/Hu3mR+n" + + "CmQgJH8fUlH/NlVMZjKHCWNsfyX3+p/53h/1MZA1UFrEx/2ManCu/BiYs5NIwfyV" + + "9hsjSn/V9nhY5PhjI7Ullm1JVllLfJtZNrGVSVH0hBWtW0eniUKWCpQplb1tteSG" + + "W0qTK02llaKdJIwk+rhGI29xHeDU7WszdtKrDKsoRP1Geg1MyhiYmBApJgHZ+sFf" + + "yDkcXDK/ydg+VJSP5sSdLVsKtSHjkwmzZhbIuvbvTXnHN1BiMYylZk7k/LKCYDYH" + + "X13JBDq8YZURZWoixpkaIyJuN7+dTwztXv57+nThHDDHBkYhVKpPSK0UGMMYTbsK" + + "VqDzx4I8qh0+G90AAla9VKVWaW0s7IZmGGCsGJhhSnC6DSPacu07EkRI5jWcLUjw" + + "/d2+p5LbfLw/ft4tspaVjDMYWjCpQqLBUhDSjgT+k9T8hNA7KVTkkn2GnDBRs4gq" + + "HgJXCnB8vaJ5e0/l/WLbZbFLFUpVRJECIT7iSv69sHJkTAi1mJkzExpMsxUqaYaU" + + "miWTRpNtI5UcttEXFPVdQaiwV/wNOFTaFSaL45y+41lrMYcvR0CijhslcNI/0x5X" + + "Yo0kXy7cq/RMSNtOU8qn+U1IPp+mXMmZbhJ0PZ5BISOpVSySG3jR/pLeKmXKxwbv" + + "w08D+N6WzGTJkSeyhTax4Km0mkp+2qVI0rFU2n8SvhDnkx7T+ba3mQuaiT5PhZj/" + + "BPIPTKvh1If7V05H+Z/nVSKcn+SK/2dX9F/Uvj+tYktW6Y9SJs9U8H2+uGZNORKn" + + "w6+2/Cqtq2vpfTblsuXEmsGzllqypVLFYDCVIQ9J3NuEfwGnxGlfyMeYjQf6WRG+" + + "x+JPz9kl/QyP6sMY0xZf5xV/I/U5f+p6o7h0sRjp934eHA9K9T3ZcSNLGkno0CQk" + + "YVp8JT0vFuFfq7kInwp9TyTE+k95/GX6qj9zhqP1y390T8OTsAJxZv0pBjS09ndu" + + "/queeVeI9GunPNTJtIrybqni5552x0a9g4GMHRBAAhHYgg4OGOTGIx0md24x2cp1" + + "ws56tnBhyqW7W22GlI2+w+z4NJHpLENNvsSMmLVcLMVj9GSBNLTXNtfwxi4U4bKw" + + "MhtuWyY+2mWYp5ttKqpA6paj8vKRxEawvhY0NIfgfiH9z+yajt60n97P+eZ9rS0x" + + "W0+VV/0sP8sevxzxZkupTbH8sPl/D6tcrSqnhp05PlHCOok2cFqHB+kTvuQ+xWMY" + + "xjkg4SNqTWUt19K/fat9iuFW5XN8JyNMVvGVP7r82PqvjL7jtfwP8yYr+QqSfsJ/" + + "jvt2zClUVYzM/e1n9tRN7Zd5buwMVVKqRKoVR2YxVWrU0/hHBU0sekk5eWPDSfeZ" + + "dQOaqRT0r4rFtLHeZaEkiKs8vN+vcjw/CGRlxRVkq1SPDFexPt0FOvhPFuY6Tbab" + + "lve6MycQ4l0tzYO2m5eZhoWcZUOk7NTTLtwdLblt25Jy6YaTDpixoPYKKYtMSx4V" + + "/I+Nn+ZdTDBNJM+LfQOkttkfVOk7faSBw+y2ei5ZhaxgYP9nmnNi2FstI8cfri5j" + + "4bHPFumZbbbybHMpMg5WROgw+Q29S8lhiiGULhSjSdtjNpsyIlsyhYqxbcJrYw+o" + + "k8CH6HRjSvDSMVFQqqko0xiIclqrGrAw0hpi/ouV/i2foVy/oK1INsn/LKzEnZt0" + + "0/TfY/WWsZMkwqJFKpVKpSGE5kJD5cnT5T6BPRj2k+rIH3fSdvy2kEdD9W0T4tsh" + + "+40PbR+xRPpJN8azaR9OJJrfGcJHGHBw2OTGMmHPduPz+ryTH3/TGTMY0bTThPa/" + + "xbhjyxUTFkr8JJwYmivf1xmZJq2ySlSoJPBIfK/rASBSF+cM/nZk213bMmBX5laT" + + "Tg0VqrbakxFiRzCeLg1rQx4xf2Vq/pUjo01d0k/Vy7frMy3JIUqSKj8lG44ZP1xk" + + "y5bcTEsHL9YMZLGF+0n1bjZ+MHj6OXau8pg6GVof9Cv/Y9BbWvn632UMYJoMElJr" + + "W1JQhbfu5MliIQxxyxlFWYJJSo/lsdkj/9Utg244/f72xHsUqlRVMGPuJWipOBhj" + + "qEkxqGNgop68j+4/mhRTtlWMEwwuUKKdDCxGGldP8X8NFUz85NW01rD7NpifMq2W" + + "o7dpQsUxivU9S0/zYuHDin8gytmwSEj4WYqVwrKqFn2kfvYWyx06X1X93T+Vj5iv" + + "X+C0fH6nAMNqMKFVXg8nuEYKKk2Rtat7V7zXsSJCUSSRT1tPuvGtNOFnGGB1Pnt/" + + "MW1VDT4EQ56UUWLFFBZqjHB69cXANNLJbE0k2zdlNHR0OU056txtowmLOO1WSsa6" + + "mpA1B7TlxdF+0uvItZVay3b0whrGdccXinUpEidgaTHSdubVUqqtqqabViKw14Em" + + "JmDeVXXLyvKySljtLGMq1t/wTEMgWhujLDJRJgxkJlQy5UMlB40srBFeLlq7bpq9" + + "ptq0rbSxohSrCmSRMyzLLLMSFMMqVksswFVkqTKplkqwklGCsCyqplQsWLGMZZmT" + + "JwN3COMLWLVtt2fFUij5Hs/SR03sfZ5nglZWZjJSqn822RTBpyxvWHlVKjTbGVtS" + + "KqskrbRpKaRWKlUqSk4VwY4cYMNTGkW1bk5Mk2jbg0RUmojT0wxxKQVYhbbLZbFB" + + "oqok2slvxSlrqul/g7aXHwxix/68Toof7qkpOaD4wC2yq1EwXZiapV6/hsyJvBiy" + + "EnDHppUrseSqqll+rGDc5R6WrvWH+G9by3kboLdJKq9H7sVW0OfMc6vWl01qZLMZ" + + "GXXa6QEItcit7KxXTeedbF5N5WV5LJkt1ZLKLEMplYlj+iTA1EdNMJwtIUTETRhJ" + + "/Shi7iTFIxhiMSWYFgxhilFclagZLPw+zk+h+o0bMSmKxOFfTOrm2TbWXbWV6uG2" + + "zX+jEamLH9lX+6Yr/YLxH1w5c28qRqX++P6v9czJ/Bpq0wP7uyQ7eB+Vf7n/N/A4" + + "I+n6Oyqaf8ybStl8Wgvg5aMWKcsqRmLCpH+JHY7+o/ZUcf8bQ0syoa0yWdpVOGka" + + "ZNpjvIUVJ+ZH6qhX3fZFanSyHdkYpGWGxtjGKcNMNKwlSpDgp8KdD2cj9bMv9zY2" + + "4SHDkmkf2xkDCf6LKQfCpoFaOJ9BoH5TDi2/9rCRhPqSKlR9EcmpFLro0rH4U5fo" + + "dOMs3lzLMZaKYNommiU6RuIh0nD/kT7lH58Cz8XLMuKhGo2V06T/Rhf9p9apP5P0" + + "/xq2rWqv1erT/PLMqx/K0O2Dg/csyqf8VH92myX+Z8BRTxbZHaYmgsP/J9QmCR+7" + + "y/0+qv0fCnyiPJSHCaH4SEiYfT7Hsxa06QsXGmMqTClIxIpRFUn8jGqv7oxG3iH0" + + "WUiCZpN8b6/n1+1fkq7ffeV5XQXGJARn3MyZKRCosJhcTJSYUEP9MYaSlQxKRSo4" + + "T/usWhVI0Ps/HwzGMyRhR1q2WLastVljMZmYxjw3K6VX+qMduROGGFymqf4nekcJ" + + "jClisYLIPl8mk0rZwHtB+viyyk+VPL1HuRApl/cZMDw+MZfZt7Tx7LCpLZS/LK6S" + + "W2SkqS0scvTSTnLcGk28PRKVpMSUr4PizlmNNE8YGrZq/51JSfi7Ts2T+5Tuf5cL" + + "UaX6LUnQaR5PlE+ZyTiUqVaOZTHx9XDIqqOjpwldJmO7TbfS5VtUwninQ/6Jhf1N" + + "p/3sSnS7Y/q9Btj4/60tF5xmT9MwRXPy8PM4fiKUOh/FVVREYiiQhAhEa3qu3nv2" + + "d7+q9S8O8rb0Bs06WlE0arExG4ZViJk4YG2Gl1NmRsyoMpaZV7PclFEkhkSN7T1+" + + "jx5uV62pGsk5ajBRIogIzWpucxals3vLLZmGWmKYUqcpZRpGE2OC4rasjHDE4E3a" + + "VkxkzLZJSckySoFD8JNDSmOGxNtM2uJgwFUYSjFFUqlFGExq2zQorAowoxy2rlV/" + + "wdJPWk8RjHBV2lsFjhYX+gysyZkxh0f3RhVg/4UcJ6TuScH1VPy29yH5DloLCqpU" + + "qInySSwxRKrl+50K0qqo24TykjydiqiUngn5KlPjr2zMmZmZlXDMt/QmnwPDD7q8" + + "JHcLH4WjVHYxiwsKx8JjVH90Yz02rRwptHkY4fT6Ksmn8HZHweLk7kPRGKpyh/eq" + + "bPRt8Jw9H0f9riJN29Ik05PjeYzM7a+qenD4QbH4OfJwfZMB9ytJtyhXEiMJiVNH" + + "cUPwV4H6o7H3fBXSflFn+Sn3kdp9U/HhSqjtSP/YlJJT9D1KWFG1D7Gn2HR9iD60" + + "4ZhiiTUjaPujNmxMUhRQMUxVYpiKFSJkVJXJrRuOpD+nmZJ/LmR07HlWk3VZMyK/" + + "m/D6vP7Ztqy2BISPUCQkdu9bzXnqeuj9E79X9hjUSttuMzBuJcLcpmDmXFzLmW0a" + + "Nra22stGjRo3xd71/j7CrbuqNuCV+Pn7RiTiM9JJIEgAeHxJdEfM80MFtPnBMxsr" + + "AgcxJUHBQgNneHDhd46b0pvHTJccMlKYUIk+5RcOXp7Ryfl0Nnc0n5iTGzpiTkxo" + + "FCf/H09mHBodkFJS2Z2cs427TqZEjg2XKgms0uWP9EwnyRTKCH4BWvY2oHETm/gw" + + "zIiIJE4SQGl2Ck88xdoqynSIaAsnIZAHItqcqEkc5usa5371h9/ghm6wvaD++Ev8" + + "O9O1aUzFPwkL4FbXvIfOvp571rp7GmKUGlYdK/70n+m237Stjy2V0w2w6YfZFPh9" + + "Hg06PAx0ppwTTGGySp/LydK8/p8z7d2Zmabu+zmXHZJtVDh9axBEEQczHKc39VaV" + + "T4x8bLS/TE/iYRwjwdM0rY+rUH8HTgw/pHI4Jporpt5nzbKmLJH82WyJNK5mnJ4D" + + "eABtlKSyi0srSV+jHaGkaf0oL5Xqr49f2cO3KPHdVlOlxT2Lbotv5H7Pq5pfnuZz" + + "/dmMfvq7Hqnxosaf5U5j9bbH6/WKPbcO7bK+EPh5IfmR4cj2lOqW0RIh+qOFlpQ4" + + "QPJP14ba1ay0a5WMszhMV5f9J609T6PlI9nB/Z+ltJpZfELlyFYfUpiTUrTJy1Ra" + + "mlkyy1arGFKjH1SmRptiNFKlHlOxTypVNuJAVJ4ErlpVbYWdnGukOx25SUDvhmkJ" + + "SKvuGWZYZZExglQqFSfb9gSRHe26lLJVfZjBJ/oiPHr3rq/pJEQkegQkCw6m6pxf" + + "vmXePsQvn9xLQI6KSRQIAG3bEGfh7NUKcK53UPq8OHUkcacJyvTMdOk6aVZtbeXD" + + "JrDQwQRBjBWHXQ31cy5mBlRZ6IYlcEmEU04Y4cGEw43ZacPubU5VthDlicPuw5tq" + + "27YxgrGOOrbLbUDHk2YqK5Y+iuHLp5DT4+JNH2/Z8HtbEa9pifS5hRZbRbRJLmJk" + + "tJK4MBO+IfGu7xq/hYNWnTpGnT2zPJAB7pIdsgDnjwae+mHsZcy3KXSR8U8MMHx3" + + "67L6cwtaVLbW0oONWeD2UwAhlkYAd9PyGVl2b951gXi5PVcb8QkPLMTq0gBWTz4K" + + "b75X2bmGXKOkz4+PNebXzvhX0lvnW92FLBBb7Y5NtIVito4Viq+U3q3G5KxpPY05" + + "fL8uNtqqVHwkaYHg7TTw5Y28GPVWo6bO3c2dGOmk5G3CG38p48S6HjlsNF2N5UG3" + + "rhMMNpgtTb7iCOst5UUraeXaRgqdGFNmIlmjFNDbT2JT0+HDbb6fWUsvKq43XF85" + + "mSaaDRzytq8wj6ofRCj5SpbawpLGJ941qyZFjLKFSaYxiaJLLaQhJJAkhvLrtqoC" + + "ttttq21FiQaI9vwrDxA5e0qy21HycDgaRwSPs8Q8LbbbaEEqJAA+29r5V87e9va2" + + "19Eb4CSiIivrXz3xYwYxlsMdqma+mXMuMrKWCsMVUFYvUsRaVppRgxw1JXOMb3mL" + + "yozTBtdtNjDDApBMAoSHCRowphkwjDBucNtDaRKMMYKomhyNY0ck0nxv7WzTGIgK" + + "aWfqbVi/VMlGxYTH9BkkfLWrfruDbbbdSUqaY2JUcG9pYR+O0/p+5jB/JZUMKxWI" + + "qpUVIKVEVQxZMcum5tZISSZskAD4W+H59LNJklKlfGlrqabJQptdXKqVKsqlUqOA" + + "aRSiVP6PeBAlSQJCTLBC22236NPq6ejHcSd2rZE7YfVPKyfUT4b7fr8WyefXfb6N" + + "MyWzwG2mEp4bur6pan33d8BXGubpOl5ed4jcsltUaNEoRiM8GkA0MS2li5l+V2vw" + + "4XIm74fHps8HR/jS/q+HQ8pSv0K84J8+flIn1SJ6+UsU+C0c9Aop1HStKsYGMDKx" + + "VVbVX8PI4Q6YTdhxS2Nirbpbf9Rt6er8OQx00quK/pxvKLQgCMAPno3LmmAsuG5c" + + "3ARCCJ9nkfLTE07UWQ+xE4dfZtP3VPs7YjtMjphyP+UhGz0R9z8FYVLWVdq/Htqr" + + "8qLbe2t9wr6vumCB9f/1f4sdo/2GBgKKf9A+qrofyy5yaOmGMYh/zf7gpXixGz8L" + + "+5/xfK/0YL8tv7GR+gqTsvxJ9Ht9VkkLIxYsKqMPDNH2Sv8q0SrVcBPlIf3fwNJ/" + + "tUtJJygp7lJ+qPdeOJP8PnGm0/cbR/Cu1iq/DodIqyKlElfh9ROO50qsVPQ/KWck" + + "mmleZE/KwjD935YnpOIH6pJJkrJ2Ojg/KkmBVi22RUNKkxWowxU7iMnlaqlgNpJ8" + + "pj7iYnkVUWTvh03PCvJ5UwWAO+/U+8rwtQ/m/pYcu7dSLkkqlUIKb4AdxPxWQX6d" + + "K8cR/srlNn5QkJHSlU6YlWNKsqyjRa1ZMrLLMYBj6NRJ0TlhNqV6ntwbHC0tcGIM" + + "SikWx6q/J86IAjICaXDPuClJRcO8kmItQriaGCUlFzXDGSLiFQTqmfrNOzl03Ole" + + "IMWrYKKbCrtOGYDoM00bf+1W6hV/xyoRH9H1kIxEKqEqwhOh0fbf3XzNt1ZIaQ/Z" + + "Tcp8CVPCpx/rV4xb9LJRO2FfAhRPU75RFAhEnDwrLCvgVkHFpWj6sNJo0rweXtOp" + + "yT+x5Tl0wTwqLD3pVXSJ+5+RtPl5TqEhVD+w7piTk2lwGKf1bfq5W39Vr75V8q/9" + + "/wWTBGo2g0WqS2itFWqKtY1WosWrRVYrUaxWiqxasa220FtqxFVbQaNUaotGxFsb" + + "axtbSaLbG2tYrRrVGoitRVEa2iitFFbRqi2xWxVtitrFaqNrRbGrVFWsVtrFqoBZ" + + "kqzAMyJmCrMpSsxarGraooi2o1WxaqxYkirFkFgSQP+X9/8v5ZP6G0/tc4bk13k3" + + "JrvDkTm8Quc3Qw/xo2mMqVokQel047gDu6KK9vXSItvS8kwSVIXbC5SCkWVJiFZg" + + "hUtoVKxalLbdMKjlWErKlStSeOmTUeNgu7o2dzriub3bxvGBNRCbu64Y4kT37cPB" + + "IVhFJFkUhs5l65OBc/xyiJn9pvMTp04GA55Yats2p3krH/20yE1IIqJ4GE72HU7u" + + "YYM8Ubq87w0emUBOg4KzHejc5vnlBVjwWj2JDp78uxUmIZjGSSXv2+C+Vk2buCu5" + + "waLzxxtCqTeYuYkzGRiwWkxWMbuiWxbDiVZW3Hey4sc9aW7DLDfXXvBO8UcMOrE6" + + "ZHKIJJkSMuZM51ZhDeUpVpMillJZpvURzSaUu8TxmWyQ4sN1HLGJuVCyo1rGYzbr" + + "G6nipyrXO7Z7vS43pcWFeb5bU4saY8yVux4640jFLmIWjVTaVtUu6xHFmprC7jGK" + + "0oY3kblGmTI1k3ubEQo4klMaSc87iGrnc67p0dLLSaMM8WbgykoqxHuhUIiSVgcN" + + "s4ReusZ2W9pwcOl7l6OFfAh11ZNRZnWh576MW2q1bFKxVnLe+3xhp5sO/llybe2u" + + "6vZwQiJ63JuaKKNCGBLFFoua715rvMY1dJZyLBbrOZ5XV5qeIKQWC7JDCltJRnjc" + + "MWVKILJ3QpiLVSjwUMweGw6NEzJrF1i1Fr4tLGZjFiWmbSyagjBTJHzlDjD4ecQ6" + + "82snBkEBIfIt4B0kgWTyUekmpzCiQ5yh1wM4G8SeOG+NNwKdjDrIdZ3nnxc5azJS" + + "gWIWMigBFTrbdrcC3d1FulyStyYtcJGJReZlFmTVNTS4yPGPG6m4mU4UpUnHfhrr" + + "wWZWNdRvxxpo63XA16Gk8d9EE0Xhw0MmKiDFJNWV25mGqnfPHiSZDmy0tLVotC9m" + + "E3s7B8efHiO2NasFiqCyLUrMVTLjOkidBUijvl11NMuFdid4Pnq556pj0CZeWiKi" + + "RE4EFhe7nIB0MWSoVFVEKlEgdTKChKRIxmMBSnnMiG9dA90RI90p4oXnQyoVOzwO" + + "XmFFm7kU1EJfOeLl7pwCnXR2AkONIgVXEixG8HO3zk2uUXZ4KDRPGOMQcFigu6MB" + + "AynwUr5tMSp4Zm3S97lkYwrKbmYdS7N0thbaW8cMcuPGm2iNlkxeVSsrDdwwNvjm" + + "OMsQWV0bYCzEe/EuduWNOYe4t4neTnLWQ7yaysyt7Nq5jW3w84tro7rFbxrm3ROc" + + "yItTKia31oMVVVzMmKibuKkZYOb3Z3UnBYN1JxUtiasqwcnVw0qRd45sTvWJOrIZ" + + "cp3W8pbyud6rMm8TWW/KOlHvrjW2vNJMEmW6wk8+aSBDqHZe3wLGK4+WYxQYao+a" + + "FMLu3Zia4DJiYsHLW8vWVSaquNQVVUQ7dSGGWs7cgmMXdseVDzwzwgEvmRsCB5fB" + + "QVQXq0Zj5wJrB6UFaTgUTjAXmHe6AjIdsFIpFIYZ5zPJpMFN97axjrOebjescSIe" + + "OlxIjJYuYzMCWWMVihKxiTtW+9a1edTMrhldTnO8F0E1nhOr4yVONeDjTro3vk4e" + + "VFXbfM/6MUFZJlNZZ+RMiADvEl+AAvwQB3/wP//fyr////pgQg94DwHe94+e89AU" + + "H2NBDuwvr6eX3b72JJyiefd58+Vd8GQIqkiC6wJSbBm5uQAAAKq7u5JKoSaaqQKQ" + + "l21VBRUlVJEKkqkqklKlVSiCooVFg+BcYAA+7T5I+gBL4hzdzp5AMgOtGq4ADa13" + + "bYpbuB97AXvu0OR1329gffKPus6EiQIGhBMJE8hNE02U9Q0NDQGhp+qYgkgCIklT" + + "0IaaZADQAAAAAAaeiIiUn6JqJgaI2hNGAA0Bk9QAmgk9VJJEyZJ6npNlNNBoZoTC" + + "NDaTRkD1BiBEiAiKRKekw0mIBpo0aMTQZMjI00YIkiARpomQhkE1EfqnqNA02oAA" + + "Bo53OJuRwkNrkuMUJOhNQiCKMocWFChEEQrUGVTGgg0sMW2bqgkJBgahUxttdb03" + + "1poJEQAhSSeqS4RwucrgpgGDRopQUVIkNExkDQSGATIZGCmTCKIkUjZJZESZSaMx" + + "BmaRQQFlNGJKRIQihnBz6Pqb1dXa7ucrjgmcuCGgbYNpgK8AKEFIr8o4gKQFwMGj" + + "vveHmstx7CuEmmgYnRQhB3iu/mzlcrWdLQASIoDpmY0D1WpCxNppg6VoTStS8btY" + + "ssBpPUaC7k8vu+aXzwycRqJj4XNyCaEL8W6PxaWpQ2NtCG2kMTE6TpoDCHUaLpoa" + + "W1Dm0upHlZaDritXaTgmhQQNtsojjagMpMIthjtQ0xZUttPCv+T0I+nD/mkZQ8ZD" + + "zjB4ZdHI+/AJQaEvDFvWEt9eecKhyJv73XRVYff5934ryHcPuxRvk/OTX8AQBAXI" + + "YIooDEBEg2yTSZqtrWliJNFtWstQg22mzaljNU2WpmzNipNtVbdVtq9Gq1bKqplA" + + "FijAQQWAEEEFi/vVAFgAq0IILEWRBPH+qAgv4VAEvYexHwNTvPzKQKnq9pQt7ith" + + "SFQE3KoT92BcQS5rF1INoi0BQOEBIieUUBAgVIw0feYQlJIxilA5IyloT2iIDEdI" + + "qoG946hlU0gdFhujgx6GOFTZJSSpDwQuVTcllZOqH4ZyZC0BlmkC4cCwsYRI2uGk" + + "ouXauJiysgW2UY5iFJOlmzOCGH4iZGZYXJxDLdJ5I+okgLjdFcGyxGcTuXzC2QNL" + + "MmgZDlHJwpxaWwzw0jjTdXZYSK7Qr5tMVE1KLGpqexpkXBFICAcNsKQUZzMFIgVm" + + "knN2YKiGSuBbRzatIQgm+KaQZAS8uDHTnWrudlkM5iRrvStxKFwKKVWkrxS0Gc5b" + + "46jB4beDQDNZhiAYwuRpE1mlIxJctXj6hyy5cxgiVA40kzeEpxsaUJjkvd5gjFhh" + + "XMuSAhJw0YIxgxczl8mAJ0klHCWrkkchWY7a9j4Nu7SQ0sThJQxDvI40wEU4mYE8" + + "5vWPNKDdBTZq8WAka53apCRSSNpCqgUBIEqkKIRCCLDdFlqlxAohLqDOd5oy51ju" + + "LwUEYBLpqiqzTi6CEFgheJY6jhnYUa1qiwwzdN4qAkZJTTMxtG2YbaURoLQYUs8E" + + "LNMt81O4S4MhIrqC8Y2RJqiBikskgX1Ls0fwJ4OCaGBlINkgmKE6hXECwCkyUOuw" + + "dQqIBJJNGXYw2m6AgaYHhuJJJCxy4jkmrBKJZbYWNXa3ElQyVBKsZAmKeWFLmqL/" + + "aqWV6VDzrw/jTfYq6/bw8pT5+4NHZ5DpJIDo3mpeN6SJGMka7izeeoko43C2Epfp" + + "g4TpoXY3puxOTFNpHLlJkTMJ/cig8exbJ4wXM1wqI/cnSPX4zRN3hNeGDNBlDPCc" + + "RjKdSlEXMcLYVo5zrESzdhn5oQgF7Vy7d/xXre3+0a929Re2659oOIpGmnWprpit" + + "uWOpOh/bvzdU3UXeNVH5d/XiT9umGfzpTP5/9FU8nQ2l+WGPykDtzW8+x9V9eEZL" + + "xXZrntkuw70ekWyrvMhHrucZm9KfynpN9pZTE+0MTHTPffeZ6Ne/Z488WceGj41e" + + "xPJ4/IOaZmtZu7us13BA3KgkZGgZhXkEnmKKSCdMrtunVFC2hCzVzNmb4pa9MrfR" + + "5L368R+A5cTbzcuFIBItqqa9ZJWrv440HQdtONRRNMqQLRvCoXjJsHsNjp3oqjTU" + + "nuUk+tSSqY06SBeONJjOPZlitBWP2Y/a4myrWhja8Y48ITl3w70cPAUvOLu3N73x" + + "oNCWxRXKJMZBOcsIiYNsbb6IqgA1MYWCyzFLX46tyDIsrZmBdV11KBpmbcG2jSmW" + + "klZqbJwQmXHcfS+kqBbvzhoFYwQVevOaUWDtMkiQ4OL3wfiGhdLDJF2oWKWCGRKi" + + "hQlR9vBWB8QPr7h+/XlnwgBkZ6IHoruquvYHPb3d2c9Vu1qFs4DoTfPOZy5eaTfG" + + "EbeW2TVkZWcjbLyy5fXm3YKb4ufb/wb81JfR8qaTCaWBkN5OAgOisFhTR2+eXXkc" + + "3pGtx5da9R7O60uzr4vD1ctQeFni4kxCBF61C2yR4amYWm6emxGhMsrBSNygglLJ" + + "ju41nhlzS1oTvHIJ3iKAtp6aslyLp2Xz4u2mDjOOFZxL3c45xPx8u1djCMsttzHL" + + "vlwW7OA48Dxvhzz0vTvl3lSnfgXC1bTvQOQPN9u0GMqUZDiUu+0SqNTncw4JrOJd" + + "C5ae2h229JhHJcsamPYtGY2nqSYKK7ZkCWcOaeo6wnA5uE6UmOicOKSlx01thtO2" + + "U5RWOvTw6+Fysmd8Kd83F6zpjTvnstmbnM78jhR6FmzlfenLa9NuMaGgsxrWUpGv" + + "xczOq5bXKtNQPDHEHk5QkHLA7Ei3HDC6vuGTk25mxRUpKKkrlGpasCNz44/k+3tD" + + "wDe5wjgdDHrPy8gsg2W5zWGfiMkjEJmgQcnm7BcPMOgmPy6pIvZOyXeDh5m5rpxh" + + "u2O72A7GexroWfc4Pg/Hs7+FoQ8r9jIQtaxoXODg+TR8z0PRzeAOoeeRuMi7hdOS" + + "81h4GqNyguIRmNhQKnFMJWaZLQzV+urXgFRWKiY8ZIxJo6GynpoUkgAnNj57hPkk" + + "CiIEgKoYhUZF/EFX75QYsoLiXAfylQHsFzFbiMlVTCoUCVRu0SOlVOuaqN2WvP1c" + + "77nObXJxriiMINSQogBTFkqqmEoC2VXvQXneIkUdJiMdJihT4fO2rWLdy1y9kXJW" + + "wjNZBRy2pfGS/8Lwdy9Cmq8fh9iYjz/X4mvTlzXpX65f5J38LH6DNGfi2efIIvIZ" + + "10n5NE1kN59vlWXnOfKiq7ER8fWpiWWAkhS+t+LrfbL2atTnX7FlB6UvlXavrdWX" + + "HX4WKTvtWbyZlXdbue7pYypbJ5UnERU0llbaJ5ZvPfC98s8bTLO12ZXNItLa866P" + + "2611pp3tR1vrwgjnvvzhWTmUw9oSQv1dZnBnZnRGfK8QzR5ObplZCCc5ujfT9R6v" + + "JL1s8iD5lDfnIokmLJsX6RI1PafLCcKs/Tg4AkOMBDBIQit/raxnAKMUBAZBr9yq" + + "s1/QXIbVpWgIAgmEILgYvh0yWOUmv3jAUfKBfkdBqK0fOeYVyHCSZHQ6VMFk2HIr" + + "sD0RNdD7WUaPgRyIZcjoUkiB+YRfCWIeIcpVQPm6Q1BfgQaJofhQUEMgZOGDeJA9" + + "IPcCCRV4AUgAYPdw6IdQASI4FnXKQHmcg2w6ALxIMpE3ZaAxxeCoTJ0HTJEbxQOz" + + "vOl4O5xZ05zeiMkPQD3Jg7lQsvJS7KCkLTfpQmQlEPQs76EiGVGr9s8U7Q7yKUh6" + + "XQJAgcEPOW6rmfKxk0kYB6NnWeroUq8BmBHowHKGqH4gESifAlozD0+eQ0j4kT02" + + "LZ4WaPDW2w+IYtHZeImTcCWCRQLWBxyHfijRhjIpsF6jmAN08BB4SheIvMCQv3O9" + + "IBxhPz0SkvgHt3FCKbZGAMBDgJArIhI9BSIY8gc5jHmj+E+p9S/UAPryP36WOYnx" + + "34Ii7m5qkMm9mPRFNHfnTkYoj0GQr4OOeHrNeCzAYlhhc5B9Dx8dhsYr6Q8qgkWn" + + "ZzILYoTDz4BIKReoEWCYEF+GtaVpIuJ9O+zUiaxtJE68pepgbqZg0bMuPgcmlPnY" + + "g6RPUYjuCge0Uj8+CFpsWlfLghvvAgHOAUAaHOuBCwTEJ1iNdj0An37bTZlzLF7r" + + "i8nzHeJWS8Y6zJjrLCcqH4JHhRMidIZSkw8EIub4C6LDowDzJO0NYq0kILgV0Xug" + + "kCCZveXnig8iigRgdCLAPCpCoaA8AMX+M94icjIEiHwoKCEQhEX3HtmPnzHMo4T8" + + "NPcs2WZJYUlDwPX7E5AKIDuKSJ5wxZlKKsPwLwU8KDrAPQyZ+Jla9ISK/IHBC8hL" + + "AJi8KMiPQXfpqpK+sINQSQJGgioXVwYxvvIhV0sJEIsZpIely4rWA1B7CQPyZJLQ" + + "OahcYOxhvMPiDui49WezMfDbrdT686aJ+EQ2kJErap94yg2ISh+eqqB0QQPpBERM" + + "BBR+wkAAH2CA+KJEV+wAFcxBkBfIpkCZ2gULsgCIciHoB1hJQ9gIEguUgoVulKgg" + + "ntUcGAJr0oJHR6UMgdYB4JHEEfADtXgvEGyLL8+ama2oQMkPuYKfH8tziwAEEz7M" + + "qXYXsAoQHsjwQYik4/RunvQcfeEFs6nFYUjPo+WPguYCD9BY7j7j/PYGCWLpEvWu" + + "7/IZokD080Zk5wSD1AVqPRbsHEFBSr0sXtjlDoV5UI6IgNFeEvHffv4n0LiGvfQ5" + + "KFaH4Gqpz0Mxh9UDG/SNxy6H6DRQBcV+sBle8GiGx3QAXgqTMlrqSTAkr2SSQEFV" + + "9QEYOxHymNgdkGXw8Y+fRsHrgXw0GR09kMpCq5MlDiZDzgGOLxJuHDgRqQOet5Kp" + + "ezggkS1jSF0MO0JZ2yqQKSLF7UIgkEZK5OM/HYXOHJeOW9vBr8HHbkuWPxox6fms" + + "GumVzMqBnqecSQsuBDogwNRVQM9eBnKY0b2gZRHesEG2rOE4hkmdWB6V5y1KgqA1" + + "BGhikPMUQmrL7akye+mkvllmGuOkpMekkiTCSRACmrhLIlulAF9N5rthlpQ/XQkp" + + "01zssYOxeeIYRSTWbG2KBe2SOKBXQ5DU55aOtIvBbCk+zYig+CBkc6wH3bQOiaPv" + + "iscLEZjILNSSmX9OdgQXgna+HtgT0K4DwhmvgWOYSV0NSQuh8OHmg/ExtAoX4Pob" + + "q+dVHoXJ7hVNiGlVA2bGEGEH1bRIRBDhCQDs2oQtWIbppQHsVDJEQ2qoEALIiIJh" + + "iA5Ibr489zs18KLdIk2wVcpFRBx6+tiaCCj5EMxEzMCxQyTxJ8gAo5ZcS4gmZqKG" + + "0IlJiAbs+AEAgERPIieEQN50HzB2KnFiLFTJR7Q0qNQ4QXyCtKqBvJY82LSiEDtD" + + "SMDyDTVAlMx1KR0pMIRUiJ7YF7xSGDGU8MEIMgEjhWgojVGuXwHA5gtwUckHgZqo" + + "ezI2FDLsfUAQ3ZjoWaTPcjarhqjpVVrhZIQ6SsgnCohVS0itMJYhS0GK7o0K+ky5" + + "Y7gH3tCGO3xVQLLkMHlUMsfgQTLECRQxOLscliplNO4omhGOIJICZNgKF+kPDnyh" + + "3ErwNoatDOLWiFE0bhwyOBJEYDfGHjaG8xFtMBoWYA6HNgFycuim5Q7p2qoGrMrZ" + + "iV9I6DYoCVwCNjaBmh9VIACEQL8wi1kyAWKD09rwynBSL7BDbiUwABZHykpFUzkw" + + "tIaZSwCn04GkNoQOlasfSOXAYa64AHCJyMVG81eg8guTY5JtM+Empxh2Tu34PTsv" + + "KYzszJQ7oZY4pJ7Ci6JrOjEozq8F0gbgliwihrt8mJA2tda3aqkAfanxBmq2ZHU5" + + "0MvBycGZje43sNn5CYiGYNwJBIRNj/EqmR34YYffKj41OKr74Ihj1OnAC82B5rJS" + + "xuPCk5SnOICrQbAWFCMDZEMllsNkyUZkhMzrWJAiQm+4YC0K62MK0mlrmIc8DWIE" + + "FjI4sXzhL8vpkYEZwSigrGArDcBGj0gGFAr4FqGFQ1SOjTvH0TulJ1XWHAIDBQFU" + + "2BL7SBXa+99dSAvxCgIPnOIVhPMmTqqgYRFDUUEsUuxDfjmwMpaAek0+O9i+KyRp" + + "AG8DGE3qEdlsT9H5BPmUugch5YLMiAwTAkdnj7Y3zvRe4V3q41uohGNQNXT1Czcw" + + "ZOHoCYis+EOsTzziYOV5ZAwqoHrl2ATKFHnpRssDzmLdSlJDg7CCwocglqhuE+Eo" + + "jpsHOFogASPtXBwKZ802h3flM1s1tZA8sM4cPDnAT6uS6umbSt9nww6rDoI6wdYP" + + "ABwCkD4MpyWUDjtRIBzdU79HbBiX3vcZZGYTeQOlZsLH/hj78oFxFCAR3XQLAaGA" + + "dDiPltBD5eyxp0sa6DUCQ9yB3omnTqYzNOQ7dGkZocqlwqH9pIRCGyUGWBqQyCxy" + + "ehq7n/X63fbu3lvZivHbt2xc3MNMke2l6Uc4OiBRsMViTMcmSUZzTiouB0cMzMDc" + + "MhAn5DyXqlkdoH6TOX/ia/RnX2fHg6KQTF18xSwHCgLERnIs7MqnDBCuu5uA3wgA" + + "RixX8J05hR8PDApxlQIJmGtpRVjPTQ4WhDIBRyoZ5o1kdEjBho15A6uhLHeFCwXL" + + "+9soCWWtfZsFJSQSLh/i4cADpq1VAz4GFTiJjhUbKosgl7B751ekmAW8qEBkjrpJ" + + "Tsj2D0AkIBD0X4qoEMX0AA0zQzao5o5TTzd5LNDKrnPfRfO1p44OgI4xIzjnvqR2" + + "Kz5Gwg+DJUL4dAjsyge+pYSePvEmKovgUXXilLjBfO4fT3oTYGwHVC0J2gKaO2qo" + + "GfZ3ymu7AqTWofKKHc998pr01xD2hKFgCFCO1eIWDjYeGgvGgWPaFTjzJlNzf2GX" + + "XyGuBywpbCI9aM6UO+tOtaQSqpWu2BesY5kXgwTFHTUPCg+y8oeXVwQ7yjsYrMak" + + "XS4XXDAJlUBAhUGk7oKAYdKTLFPcGom1CBxTjSRRsoYbfcOs9iE2BKVx8w4aN9z7" + + "7xds1BTpEnKyEY4TEIk3XeTS9hcaRANIX4k22qCDj84dwRJjo5YkxitJJAO9xXTk" + + "OFA/MS7JYZDxNviHhoYrl0bDxFvhTQwSQimhAnQFiYoaaHrMgkYrCOGBtDa5Bmne" + + "OFKwdG8DmOpCyvhqGYNRcB69KAlJSFA5hCUHKDE4GFcRwyRmEbfPPpveJJIDaQgw" + + "rWJ/P78yCMO9svE7GZpvnPSWaCtoEgL2jLabbxBVKIsbSY3YtJJ+NjNh8b8AilDw" + + "UPusGoZAu82EYImSRSk5GnwVIKWpSvFeBQnOAdAMuTV9DgEQgQgvrro7JHSHZZfM" + + "JCKmTtQFOCceAYcT265PCAg2SE+XhMkKlPgHB9+HTOoLI8s4BJuk9F7wqDCjRw6y" + + "D8yVeukRZ7qrFZYrAMMmhmgFDKEdZztkqFY4HuEkfuhz9pTsXzFtqqB5Tv5gsZ8h" + + "mh8x8wAfZSHNyDX0vZDTySL94fOjqfD0KHsVflvrWX5ow8Q0QhFVMbcpmX80Ezgf" + + "HYjMuA8wLy42E7Sz3rziuCIB2DsghxkkRy0Bzp6FVAA8MKcFvSjqknlxdHAT0wDn" + + "07kBQcd9oLK7tKmnZYnZZrh6DrhvciJ0ss6vdzXdwMQKJMWT7tXSHPByoD9hWNqM" + + "OwE85ypXmQLQwbXSkJWY6qxCwo6HFcFLCAk6bCVHFyYQc5H6Ezm+mNHD03wkk6j7" + + "m480R07W+QkhCKSnJVvGUvBBlRzDZDeeaNvGwHd0PT2wTy2HnkWtuMhkklgK66LZ" + + "BC6hKMJnOxOpo4YaB5V7rgiiWQXGCiJrYk4Y59qslhcA8/XJNJQLb+5tUzHJCBgj" + + "Qx3GrzzHn6xmZ9A0PtV9dbezpCHExoEDwlrH8dllA4YEY1mhsA0dIPPsj4Mi73vz" + + "nrsvJLs5YqABDfroHBg+ShQ0IgOs44NI4F8CIIsVXHQ6z3KS4MOhdxigYOImz2UG" + + "gJAuBhpsgLrldXnhNQ4jLCUyTxyhrIrwuyYrqo6MJzQ2Wl3AdDzKOb3Cydryz5Do" + + "pHBHMKBNdAOAdXJhYMgMb2s9Fp70MSClw9KpTbdzhHAuMGAtobHQJ2SURvgbbhyt" + + "BecsuXl+2jKigzt7goBTjmpC8RowanZdxJOhWjwhwrm99FSiJ2OgLLnm8pnjT1Fc" + + "CXCc0JaZijcmjpDACeVTrZneXxGRA+184I985kcHQIQIEFMgWfO635rg0SZSO/at" + + "HtcUKa3TZ8OJoImYsgRoKAhiZKIBUsG7yTOFlDFncMU9EG4CMLUKMxbiCaMDYdhs" + + "JSKdyLFJCQmviCCLgGuUz81ptojXx2oe4d2iHnAkVSdhzcfH2K2UnIQ9u0F30MHB" + + "OBY0UHMYYjgCQTAWMbwXTZQXaOgnfjckJ+BO475Zyfo8/R0NlEMBq8c94sZJiNrn" + + "yJ8OoMIDQPjt9uJK8Rk5aFDYbJfWSynwRhgIbQoB0+IsZPFGy4yADzZLYokaBywD" + + "CRmTeH5tmhDzPmA2rD32gaqneqHMNqA3FgsMePDM9KB69ebN4HOAhc26eoGFI1QJ" + + "m898wsO5qZxBxcWUgvtw5Q8AMEOOJJ8HEEk6B45ZyIoFaB5KW8FLb/M4KYSZIP/T" + + "y/DoMk5Ami3wPAH8EyWhTaUsFlQ+g6AEFdgHlJWNLpOCvdk3q+hWdqbTJWRS1dey" + + "wOAQwQUmsxpFozUQbFTRcPzhmHw0BxsEHFHdI2kUHjDkRPSGAp3SUo8BEdPPPTw4" + + "44KbQ4SZsIKdYe3WCo1EtM7zKTu1VAoZ7hPFDfU88SlCY2aHVSnVAOBA5wzuGlcH" + + "Rs8STcvGCu0xIzUFjkwcvlheRAzgRbJkzf/N0YjQwJYrJ16VzC1gueMTW4Rt5rYT" + + "IRNwYQYtHOtSD6ShBHOQzP37jm+TT/gvnq0DgyDuezyZv7FGKF8j4kpFLwakHPsy" + + "LSDphCyxQLl7xgnr+Pl8wbTsF8dx04kwB75wFRLdNRIBmhw2pH3UCbB9EgE9z5eI" + + "BPN3vYxzTZ4nEgVR4qoGQtM+BuGwlgV1WoHG4EaoNASMhGBgXYFRVYIXlASg6LSg" + + "GqeHmiyAsDilBBOqQsS4Og5rap1miKqAdUA6AdYTWmgTRQWeULDLBzlSEcEEDJbB" + + "4nTaBTC2glnEXi2haNhLoJcdgCNAkhcqbCc44gFrBrre1RE7eydRrtb9wdNITgOo" + + "j4QWulZiLl9z7V6DbnFmgcimAjOFhQs7UI75C551aKdXmUEHKSvEOCldH1YzE3wo" + + "E42BxwHl9Xk7YSa0g1vV9CriIWOztgqD6DgKN3AvOkS3ODdnTdtll+abk1SRIIGv" + + "fALBUOBR7ZFBZ4BUpBnSQ4hFHFEZ473Y3P+zY7O60Rs1LaWqHHIcwa8txlB4jJJE" + + "w5YZFHWAZUEtKyoIGdMwDYlA+A9mFgSZbOw4M6OOSmPkMl1OYzvpRASmvvXmUjTp" + + "8joGG1lR1cQpEEugzJBUyZnlygzInkeR9IZ+wHyATZQgPmd1ZmIUecB8pAzd6P0t" + + "AUK45zvDzCusNxdKPDohseJeeAI6ZvadwEcFQCRCgsXNcDfG6wqIm732cGQgwkIA" + + "SKEgydIjIZQ4a2thurU6wysrTQQglytZnEFtKoQOjdqfOmiDah274ym7EDxm9s9L" + + "CegGgMopkIt4LQ1Xtb9yBS7B2LUpK7hUpgHQVCXmwmbMOQqGHhGVvfpgEjVDoew6" + + "qNbwaB5vajnexW8pSBC73poOsSDMENqjGDoVUvvCS9M4jdfRrEmuQYwM5KDSHMK3" + + "B64lqG9DhQ0JoNQHlDlAPccRKnfODi2TDOoYNSZAcBzrUAVglyHGRUI0bMziEWOU" + + "JYnAOUMt6Rku3X2Za5l+nJIHiJXNq4xzccGdzaqu4qJJiDRBAN2TBKurol+bv9SB" + + "CSAX8+8Hl/r7sZnxy9PYe6Z7cvs98YtZ/SwPrgMD9OXynBh/XzxwXwdWFeXp/iVD" + + "kMgNriWpJDP1n5azCg6/xxxEvwpxkfhIP9s+2nQ/fn4vF9+jJ+ngfdWL4CPb5czf" + + "UQwvVtZEuz7Om9iWrwP/ePX0KAP0+V9inRoSgybccCP6dPd+K+f24YnQ9YpYUGst" + + "TKKFMYQdT2HL0fr+fbVW3qvv1NLVbRWSUrVJUxgSVjWktRaoqKNrFWmUUVMjUUmp" + + "li0zKazDabQ0YKDYxZMGg1BpRpYUwpQCMhoC8nsJe4+Dy3Xr8S8ifkOz/vaP7ETx" + + "FiYoqdkOeLbBtH+bHadmz2QGsccbGX7OU2D+LhZDxGPjMsOyV+DZO9PSeDPkEcZO" + + "SS8UzBJ+ecnUZhlZ9ZyM/ad22YYrjBcAz/3V2B8/JiuT7ED9kw+rGGSGmqTbJiMm" + + "LSysmTaS0aks2bSzWlZtg1EpSSYlNkqItCalNFstNttqaprSmpS0pqU1LNFgKpZV" + + "srWWrM0lJM1bEW0qbEmiLVtRGZUbSprWbNaLUqaks021KtbS2RlllbMsywtspLGj" + + "SaVEzMYk2NmzWptlrJWmSoRZSsptlZZLRGTaNKm2LJmmyUmSWRk0WpqlUZJJiWlp" + + "tkjGjUy01TaUkrKzSlLTMzAbNg2KlpJMl63e7/d+ENF1fgGLHuf56NGdqOvg7hSN" + + "iHHED5NKzQnm2yaAQJTIxieFJM3ij3X3qh5AHBhk2riuNRvBd1dJNK/o55W5e1NX" + + "ks/nngBUDz7INtUfFdK0JrgNgbjAdgkJGRczQCngL6Zh4BT2UW6xEWOCC4FzQuaj" + + "OxoBErUsV1z6K8cAICwJGRj6fB5iCC6h8QhiZB9qLr5NFyCenPzIPnc0WwotMInx" + + "4sAoHfMU5HgU6hhRBkppj/FgHNLt0ubr4APQXPI06DXqSSyDZid8zuPuLwXKN4cj" + + "jq/w8zETQQQXn+w0DiEJEiKh7fzQ5LMfgQXmXrdtA+sBzTIigGxVCwsOYhmJycnC" + + "CGplhE8/sdAhQXcsIRJFJISEJE8flHQO6cgR0ZCoE/TcCd+BBP7orIml5zlZgw9K" + + "QKKpGkiwgESxpnXK9pYwUAa89ij5sPoUYZjQ0lyAcxQc/xtRzIOJISJHL7Ny0JDw" + + "BwZa4MDUFR8D5CCCwzTyVsZejnQapAVGYICC5dDXtXOsmZXMO7mFWN7P56mEGIAc" + + "JHHBsharUAUcAp9UrviBIAxJ08i+RBO3Ah2QAgiK4kThwo8sDCf0aftxqENQKMTv" + + "TZBCNMVoDJwdi4fVhYNQyMy4KjH6SlEAvexZaMCmxViqK0e1JpDA33Zg0xuGQl9E" + + "hiQvQ2FHNA6XqGDe6CB3obIHAhBD+L/2H7JweCnNu3h8F/bQAgQghowH1UAW3ICg" + + "LRMWh9MD3nL6B5zvW/rtbABAW7j9J/ubhTjE1Dh6fjPlrh4F1mHx9l6oKaKdL9MC" + + "Czogscg9WEHR1P1lXLtPyv2av6+Uc38L73W4ynzSHQzT7n4a9fw9G0pHvHQQT3Ww" + + "CpsYtnkcGJdhEoMqdwTQQQWf8H7l+Sm0erEmuPTqAC3f/RC5LqgrQdfyPN+J3eTy" + + "V4GlQVzdO0KeqEArm/KUORmgILgIYcAUkDE9WuptiUObqmYfnmExHY8cNvsWx4o2" + + "QtFrwFybGSaII/YzOu4hsM00VwmYOAJQ3KQY+rag56UiZKVHIpnxryUn41uF8d2K" + + "fszLbyzAkMTuQc1BJQQHPuhBBej0s+yiFTpnRcrVGp26/SPoGgGLAjmBAhpnAPYi" + + "hGHgg8hN+hAh0NObgHp2R/M6Jo+S9Uw80pUFedRU1bYFRVog6sTPEHADwMAG0oUe" + + "ZTzCfk4pmd1M7BJIMNGsaaugBm+bdBpLDSNwIBiBVKx5dQgre1pCrhP2FD5vX9bb" + + "a28/PP14155vN5a8GIiRRgLCSaKIJMBu9u1u/IdZNWhKp6tcoZGbueNNIlSQLYOV" + + "guF/I1QEFvm6liJuQ/g648tjVjId/WMg6iEQnkcuhltYdGxoELryIDySIMiK9wD4" + + "MbBiPihigLkeo0OhARBcol9jMSNhf2ITsgILYNseps5hodZnnUYfDxJFi4UQzXNx" + + "EsQsWIsPUhf4XvqFHwQ+WPfTBIHct1LIZYv2+juqALF8D9dhxOkM18bdDBT3QEFx" + + "IIWRNxv+UV8R+J/0R2XJbrEIOYHU+pkgRzsDEdIZEebTO4gQJeqofJbdkqra4esL" + + "roGjHL6Gsy4rZI+PElgZlHIH1++YJmDEhF6psaR1U3IWVmpF3VwE9oiTMpi8Nzz+" + + "aHRDUDwW+WIdt3zPNOewJzPCB9E6jmCYHFX8LoITudMz7/N1SyV8kTcL0XLh4A7N" + + "JzfBgyjFkYbKgC8xPTQ2NEVHr3NX3I8oB8QLJn4JCrIRrrR5SSiELOBCqIlECSOq" + + "AgtNF/5UYIUAbvmgBgPL1xIT9UkTRqqrX53ixpCNGKHEwP1PwJh+ma3ptrBwODbq" + + "SORcDEiR6PVwOxokOUEsjBbkzcaucQzU4IBkiIQDSXJdCotjbIzzDs8lfNscXA3I" + + "EjvBoCBmX1Xq+IE6m5+HREB7xUkefMhRTIUUVEoGUY2sxAvjsdB3GZnYoMTuuOZk" + + "0IILqZh+sKgLQ1ULBUF4SYf1u+nDkki7SjNoBQWIGv3PuY3TIDM1QtuJ3SNep/DE" + + "5GEdQMHhYWdISJCEh+RRD7S+bd8OK+sbha0qU3NES7e5JJCEsxa4lA5ucJdrboo7" + + "v42uXj7XKXZXimppWTWQJDU2Uks0imZSWU2bLZWUpEzCgmWQzZKmlstNa2pqlKaa" + + "aU0pppMDbLLVlqzSSa2lTEtKzZJmtWpNSkylFpqsptkZrNNSzS1S2bNoqllIpMmS" + + "lmYDKLKzVm1LKVNkglKVKmyy0EstNixZmkjEiWms2xGFpVEWVNNKkSaWUpmMKLNQ" + + "l1leHUD7BQQf0nxooh+rfDYdYFRbCkgUOlBI6EukdLgodLEh6iosAIZUDGcFIBnT" + + "5PfxeXIybIEK3a2JhwXN4a5XZyCUN1QHKuKm53cudZGkYw+CUhgAg4jiFUxQcoWX" + + "ZiDnC1kcAxisjx4FhBuB1RLpkW/L1JdQMQyPlqBhAGDxWuoWKaLLctSBSGSu4x/U" + + "+UGMFxxCH7+CQBDUTBsMAfQX99QooSAcCZEiD6vqNtZoMtphkjx94b82mEcdDU6C" + + "GIfhpBNHRGdiSEhKQ5wXmRP0FuHscjHIQQXE+/JA9QIe5u/rPZ7iGp3RjqDlESQZ" + + "JCQm/LYfclj52MSyQjrCotj6Nhs9YNtpjG0eYiFHs4e+RkLZGv6lQVs25H8UcydI" + + "dBwSSJWZ2GkMV5JBvs3IEHqRvh5VCbiosL1RQbNSevAFkgodQSGXyDwMAKI48pbY" + + "nKYY5o3AkxfgcNu/2TS8/z4OpVwpwYLoslFDS0dpbVLklyLktcy0qrt1rkkVDQKa" + + "U5mIfn7qbHUwB+pUzzDYgdOwHNMsQqIeAQgWJ7CdQLne/Uch/L74GbnkIeSHVY7B" + + "6HzdzDBZDLh9FDDd7l51/E5mJCBgdFYeAu3YglszcA0yVJwA+V7zU+xXQdNIJq0w" + + "kfMItgm3gj2uGRgGUX4BpO2ZVeDftfXE9vP1ve16wzwEEF4VAF3VrV67Ndd89m7O" + + "GA6EokveXN9MfaQsQ3ZZKcK50mcwJlSsZTgk98c5KYw84IzEZbkvNTsNqzPLKyHo" + + "Px0sFlfMO5q7Gy/RLjgGa3WwaF0oI5J5CEBrzAuFdT9Mc82Cdw1XLYdAocXnucxw" + + "MDq4Gb5ImDg/Y1aNUuciSSLGs30w7o64wiPJkCOJGESEZEDZGBLmOHlrwGGQG1zj" + + "MtuCoxq7RpQlgtQ/YQ5xHKBJJHiia0FHVsRLGQe6Aj+2KgIUQACACiJEFxCraZaP" + + "BqeGpHqJ2lIlZ0RymyqrLMZVKEz6wYDwNnVwEvXcGMYxgkEpwJK03QsQ0IAGhJqy" + + "CBkmqpjC2e6t4I+Zf0JUTC8cgiBBIMOpm5aNIYWCqlcG2GZjNkLK8i6B/LSEtoDR" + + "RIJtyOGwPFu5CEb0Y2d1QVrHSAerk2mlwOR0esAyQ5waYkWyRMAgkNlX1WA43hGO" + + "YdDY3OWXJQzDIuXC51atcCh9k/jjTxk4r31uGHUMNV7DyEEFu9aoidiNHFzHFW3k" + + "pl23DYUqswRQLrmUK++C6OIeCEEGO4Oxqcy5rvYfEQIEszhUi+UBMa/NHV+bZCGB" + + "BmDsfjN+oGAKjwgfAOjBz3eAT0JSBhgZHiXA7HejAOj31UJ0cC5soXLOxcOBUy41" + + "LJM6Q8Jwpx4F2KjgcPvn3BRaXEe2Z4vPu2/yeP+aH5JvaiC4fKQAcndicHNDcD9b" + + "ShgrZAQXSGTpCSlPzKD5gwnhsz+p8ujoewiFBY3pKLSeXXMDRxzJq44NJzlzG7rV" + + "oWrj1/nLbhdUFc+SIUCENGZwNenyhKIbAqfWTOCRY+YUj3gzmpUR68AgUjUPy+0G" + + "2hIxUaJCNpMRpoFYjY0WIzNmFoMaNFtEYklpFixGtGxg0UUVJoKiwYNaTRqTKQRU" + + "G1Bo221i1VFhYBqNjRFIKqgpJIRS7/L9Xk8v315svJO9OR4u/ONn5FGPE3fMqdtS" + + "xkZBu7kta5NbuU8MxyZMYMgmsNmMhnKfGmtyIG2LzBpqWYIbdmCYi0lYLJxwCFFa" + + "zJE6zEudHD27ZzbOeSgpk/HnkQbT7twqaaJXNvUzMuUt1hyhU7ceZcph42+VTlXU" + + "cZ9UZZJyYojLjaeJHfJU1UZUEmBfLumu8yW5skuyE9uh2BmVxJZi6KxaXBNwSolw" + + "BqBcQLj3ucNZIYZLYtirLu3brW6UYgZgZJiDIGiwpsgg7g1AITkgM6FHITxDDnGt" + + "4SDHzZbL5s8fec5PCq5DOzDRdWS+0h5Y2INZak1D29cpVyb2aVrV3Wlt7rQhLa3e" + + "m3ZwPNcXywE2Qesk1XN24HvZ2Xa6nlm8Pf/xdyRThQkO1NjuAA==" diff --git a/gcc/testsuite/go.test/test/bench/go1/revcomp_test.go b/gcc/testsuite/go.test/test/bench/go1/revcomp_test.go new file mode 100644 index 00000000000..9256164d76f --- /dev/null +++ b/gcc/testsuite/go.test/test/bench/go1/revcomp_test.go @@ -0,0 +1,85 @@ +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// This benchmark, taken from the shootout, tests array indexing +// and array bounds elimination performance. + +package go1 + +import ( + "bufio" + "bytes" + "io/ioutil" + "testing" +) + +var revCompTable = [256]uint8{ + 'A': 'T', 'a': 'T', + 'C': 'G', 'c': 'G', + 'G': 'C', 'g': 'C', + 'T': 'A', 't': 'A', + 'U': 'A', 'u': 'A', + 'M': 'K', 'm': 'K', + 'R': 'Y', 'r': 'Y', + 'W': 'W', 'w': 'W', + 'S': 'S', 's': 'S', + 'Y': 'R', 'y': 'R', + 'K': 'M', 'k': 'M', + 'V': 'B', 'v': 'B', + 'H': 'D', 'h': 'D', + 'D': 'H', 'd': 'H', + 'B': 'V', 'b': 'V', + 'N': 'N', 'n': 'N', +} + +func revcomp(data []byte) { + in := bufio.NewReader(bytes.NewBuffer(data)) + out := ioutil.Discard + buf := make([]byte, 1024*1024) + line, err := in.ReadSlice('\n') + for err == nil { + out.Write(line) + + // Accumulate reversed complement in buf[w:] + nchar := 0 + w := len(buf) + for { + line, err = in.ReadSlice('\n') + if err != nil || line[0] == '>' { + break + } + line = line[0 : len(line)-1] + nchar += len(line) + if len(line)+nchar/60+128 >= w { + nbuf := make([]byte, len(buf)*5) + copy(nbuf[len(nbuf)-len(buf):], buf) + w += len(nbuf) - len(buf) + buf = nbuf + } + + // This loop is the bottleneck. + for _, c := range line { + w-- + buf[w] = revCompTable[c] + } + } + + // Copy down to beginning of buffer, inserting newlines. + // The loop left room for the newlines and 128 bytes of padding. + i := 0 + for j := w; j < len(buf); j += 60 { + n := copy(buf[i:i+60], buf[j:]) + buf[i+n] = '\n' + i += n + 1 + } + out.Write(buf[0:i]) + } +} + +func BenchmarkRevcomp25M(b *testing.B) { + b.SetBytes(int64(len(fasta25m))) + for i := 0; i < b.N; i++ { + revcomp(fasta25m) + } +} diff --git a/gcc/testsuite/go.test/test/bench/go1/template_test.go b/gcc/testsuite/go.test/test/bench/go1/template_test.go new file mode 100644 index 00000000000..db4839a488a --- /dev/null +++ b/gcc/testsuite/go.test/test/bench/go1/template_test.go @@ -0,0 +1,76 @@ +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// This benchmark tests text/template throughput, +// converting a large data structure with a simple template. + +package go1 + +import ( + "bytes" + "io/ioutil" + "strings" + "testing" + "text/template" +) + +// After removing \t and \n this generates identical output to +// json.Marshal, making it easy to test for correctness. +const tmplText = ` +{ + "tree":{{template "node" .Tree}}, + "username":"{{.Username}}" +} +{{define "node"}} +{ + "name":"{{.Name}}", + "kids":[ + {{range $i, $k := .Kids}} + {{if $i}} + , + {{end}} + {{template "node" $k}} + {{end}} + ], + "cl_weight":{{.CLWeight}}, + "touches":{{.Touches}}, + "min_t":{{.MinT}}, + "max_t":{{.MaxT}}, + "mean_t":{{.MeanT}} +} +{{end}} +` + +func stripTabNL(r rune) rune { + if r == '\t' || r == '\n' { + return -1 + } + return r +} + +var tmpl = template.Must(template.New("main").Parse(strings.Map(stripTabNL, tmplText))) + +func init() { + var buf bytes.Buffer + if err := tmpl.Execute(&buf, &jsondata); err != nil { + panic(err) + } + if !bytes.Equal(buf.Bytes(), jsonbytes) { + println(buf.Len(), len(jsonbytes)) + panic("wrong output") + } +} + +func tmplexec() { + if err := tmpl.Execute(ioutil.Discard, &jsondata); err != nil { + panic(err) + } +} + +func BenchmarkTemplate(b *testing.B) { + b.SetBytes(int64(len(jsonbytes))) + for i := 0; i < b.N; i++ { + tmplexec() + } +} diff --git a/gcc/testsuite/go.test/test/bench/Makefile b/gcc/testsuite/go.test/test/bench/shootout/Makefile index 145fe0cea63..e1c9b7b80ec 100644 --- a/gcc/testsuite/go.test/test/bench/Makefile +++ b/gcc/testsuite/go.test/test/bench/shootout/Makefile @@ -2,7 +2,7 @@ # Use of this source code is governed by a BSD-style # license that can be found in the LICENSE file. -include ../../src/Make.inc +include ../../../src/Make.inc all: @echo "make clean or timing" diff --git a/gcc/testsuite/go.test/test/bench/binary-tree-freelist.go b/gcc/testsuite/go.test/test/bench/shootout/binary-tree-freelist.go index 071a4e06e7b..071a4e06e7b 100644 --- a/gcc/testsuite/go.test/test/bench/binary-tree-freelist.go +++ b/gcc/testsuite/go.test/test/bench/shootout/binary-tree-freelist.go diff --git a/gcc/testsuite/go.test/test/bench/binary-tree-freelist.txt b/gcc/testsuite/go.test/test/bench/shootout/binary-tree-freelist.txt index f8286dd88bd..f8286dd88bd 100644 --- a/gcc/testsuite/go.test/test/bench/binary-tree-freelist.txt +++ b/gcc/testsuite/go.test/test/bench/shootout/binary-tree-freelist.txt diff --git a/gcc/testsuite/go.test/test/bench/binary-tree.c b/gcc/testsuite/go.test/test/bench/shootout/binary-tree.c index 1b4070406f3..1b4070406f3 100644 --- a/gcc/testsuite/go.test/test/bench/binary-tree.c +++ b/gcc/testsuite/go.test/test/bench/shootout/binary-tree.c diff --git a/gcc/testsuite/go.test/test/bench/binary-tree.go b/gcc/testsuite/go.test/test/bench/shootout/binary-tree.go index 9f867d11a70..9f867d11a70 100644 --- a/gcc/testsuite/go.test/test/bench/binary-tree.go +++ b/gcc/testsuite/go.test/test/bench/shootout/binary-tree.go diff --git a/gcc/testsuite/go.test/test/bench/binary-tree.txt b/gcc/testsuite/go.test/test/bench/shootout/binary-tree.txt index f8286dd88bd..f8286dd88bd 100644 --- a/gcc/testsuite/go.test/test/bench/binary-tree.txt +++ b/gcc/testsuite/go.test/test/bench/shootout/binary-tree.txt diff --git a/gcc/testsuite/go.test/test/bench/chameneosredux.c b/gcc/testsuite/go.test/test/bench/shootout/chameneosredux.c index ed78c31d7ba..ed78c31d7ba 100644 --- a/gcc/testsuite/go.test/test/bench/chameneosredux.c +++ b/gcc/testsuite/go.test/test/bench/shootout/chameneosredux.c diff --git a/gcc/testsuite/go.test/test/bench/chameneosredux.go b/gcc/testsuite/go.test/test/bench/shootout/chameneosredux.go index 2cb1440041f..3395798620f 100644 --- a/gcc/testsuite/go.test/test/bench/chameneosredux.go +++ b/gcc/testsuite/go.test/test/bench/shootout/chameneosredux.go @@ -49,20 +49,20 @@ const ( ) var complement = [...]int{ - red | red<<2: red, - red | yellow<<2: blue, - red | blue<<2: yellow, - yellow | red<<2: blue, + red | red<<2: red, + red | yellow<<2: blue, + red | blue<<2: yellow, + yellow | red<<2: blue, yellow | yellow<<2: yellow, - yellow | blue<<2: red, - blue | red<<2: yellow, - blue | yellow<<2: red, - blue | blue<<2: blue, + yellow | blue<<2: red, + blue | red<<2: yellow, + blue | yellow<<2: red, + blue | blue<<2: blue, } var colname = [...]string{ - blue: "blue", - red: "red", + blue: "blue", + red: "red", yellow: "yellow", } diff --git a/gcc/testsuite/go.test/test/bench/chameneosredux.txt b/gcc/testsuite/go.test/test/bench/shootout/chameneosredux.txt index 6016d59a8c9..6016d59a8c9 100644 --- a/gcc/testsuite/go.test/test/bench/chameneosredux.txt +++ b/gcc/testsuite/go.test/test/bench/shootout/chameneosredux.txt diff --git a/gcc/testsuite/go.test/test/bench/fannkuch-parallel.go b/gcc/testsuite/go.test/test/bench/shootout/fannkuch-parallel.go index 7e9b98d5051..7e9b98d5051 100644 --- a/gcc/testsuite/go.test/test/bench/fannkuch-parallel.go +++ b/gcc/testsuite/go.test/test/bench/shootout/fannkuch-parallel.go diff --git a/gcc/testsuite/go.test/test/bench/fannkuch-parallel.txt b/gcc/testsuite/go.test/test/bench/shootout/fannkuch-parallel.txt index e66f779ea1d..e66f779ea1d 100644 --- a/gcc/testsuite/go.test/test/bench/fannkuch-parallel.txt +++ b/gcc/testsuite/go.test/test/bench/shootout/fannkuch-parallel.txt diff --git a/gcc/testsuite/go.test/test/bench/fannkuch.c b/gcc/testsuite/go.test/test/bench/shootout/fannkuch.c index e576b5441f9..e576b5441f9 100644 --- a/gcc/testsuite/go.test/test/bench/fannkuch.c +++ b/gcc/testsuite/go.test/test/bench/shootout/fannkuch.c diff --git a/gcc/testsuite/go.test/test/bench/fannkuch.go b/gcc/testsuite/go.test/test/bench/shootout/fannkuch.go index b554c77b104..b554c77b104 100644 --- a/gcc/testsuite/go.test/test/bench/fannkuch.go +++ b/gcc/testsuite/go.test/test/bench/shootout/fannkuch.go diff --git a/gcc/testsuite/go.test/test/bench/fannkuch.txt b/gcc/testsuite/go.test/test/bench/shootout/fannkuch.txt index e66f779ea1d..e66f779ea1d 100644 --- a/gcc/testsuite/go.test/test/bench/fannkuch.txt +++ b/gcc/testsuite/go.test/test/bench/shootout/fannkuch.txt diff --git a/gcc/testsuite/go.test/test/bench/fasta-1000.out b/gcc/testsuite/go.test/test/bench/shootout/fasta-1000.out index f1caba0d628..f1caba0d628 100644 --- a/gcc/testsuite/go.test/test/bench/fasta-1000.out +++ b/gcc/testsuite/go.test/test/bench/shootout/fasta-1000.out diff --git a/gcc/testsuite/go.test/test/bench/fasta.c b/gcc/testsuite/go.test/test/bench/shootout/fasta.c index 64c1c520581..64c1c520581 100644 --- a/gcc/testsuite/go.test/test/bench/fasta.c +++ b/gcc/testsuite/go.test/test/bench/shootout/fasta.c diff --git a/gcc/testsuite/go.test/test/bench/fasta.go b/gcc/testsuite/go.test/test/bench/shootout/fasta.go index d13edd5dcfa..17ff5dae55d 100644 --- a/gcc/testsuite/go.test/test/bench/fasta.go +++ b/gcc/testsuite/go.test/test/bench/shootout/fasta.go @@ -70,7 +70,7 @@ const ( IA = 3877 IC = 29573 - LookupSize = 4096 + LookupSize = 4096 LookupScale float64 = LookupSize - 1 ) @@ -178,7 +178,6 @@ func main() { Random(homosapiens, 5**n) } - type buffer []byte func (b *buffer) Flush() { diff --git a/gcc/testsuite/go.test/test/bench/fasta.txt b/gcc/testsuite/go.test/test/bench/shootout/fasta.txt index f1caba0d628..f1caba0d628 100644 --- a/gcc/testsuite/go.test/test/bench/fasta.txt +++ b/gcc/testsuite/go.test/test/bench/shootout/fasta.txt diff --git a/gcc/testsuite/go.test/test/bench/k-nucleotide-parallel.go b/gcc/testsuite/go.test/test/bench/shootout/k-nucleotide-parallel.go index 96c80d8f0c8..96c80d8f0c8 100644 --- a/gcc/testsuite/go.test/test/bench/k-nucleotide-parallel.go +++ b/gcc/testsuite/go.test/test/bench/shootout/k-nucleotide-parallel.go diff --git a/gcc/testsuite/go.test/test/bench/k-nucleotide-parallel.txt b/gcc/testsuite/go.test/test/bench/shootout/k-nucleotide-parallel.txt index 84169b8ec36..84169b8ec36 100644 --- a/gcc/testsuite/go.test/test/bench/k-nucleotide-parallel.txt +++ b/gcc/testsuite/go.test/test/bench/shootout/k-nucleotide-parallel.txt diff --git a/gcc/testsuite/go.test/test/bench/k-nucleotide.c b/gcc/testsuite/go.test/test/bench/shootout/k-nucleotide.c index 3bace391c4d..3bace391c4d 100644 --- a/gcc/testsuite/go.test/test/bench/k-nucleotide.c +++ b/gcc/testsuite/go.test/test/bench/shootout/k-nucleotide.c diff --git a/gcc/testsuite/go.test/test/bench/k-nucleotide.go b/gcc/testsuite/go.test/test/bench/shootout/k-nucleotide.go index fdc98ed4725..fdc98ed4725 100644 --- a/gcc/testsuite/go.test/test/bench/k-nucleotide.go +++ b/gcc/testsuite/go.test/test/bench/shootout/k-nucleotide.go diff --git a/gcc/testsuite/go.test/test/bench/k-nucleotide.txt b/gcc/testsuite/go.test/test/bench/shootout/k-nucleotide.txt index 84169b8ec36..84169b8ec36 100644 --- a/gcc/testsuite/go.test/test/bench/k-nucleotide.txt +++ b/gcc/testsuite/go.test/test/bench/shootout/k-nucleotide.txt diff --git a/gcc/testsuite/go.test/test/bench/mandelbrot.c b/gcc/testsuite/go.test/test/bench/shootout/mandelbrot.c index c177c088ca6..c177c088ca6 100644 --- a/gcc/testsuite/go.test/test/bench/mandelbrot.c +++ b/gcc/testsuite/go.test/test/bench/shootout/mandelbrot.c diff --git a/gcc/testsuite/go.test/test/bench/mandelbrot.go b/gcc/testsuite/go.test/test/bench/shootout/mandelbrot.go index 1f9fbfd3d44..1f9fbfd3d44 100644 --- a/gcc/testsuite/go.test/test/bench/mandelbrot.go +++ b/gcc/testsuite/go.test/test/bench/shootout/mandelbrot.go diff --git a/gcc/testsuite/go.test/test/bench/mandelbrot.txt b/gcc/testsuite/go.test/test/bench/shootout/mandelbrot.txt Binary files differindex 2f7bbbc6b0a..2f7bbbc6b0a 100644 --- a/gcc/testsuite/go.test/test/bench/mandelbrot.txt +++ b/gcc/testsuite/go.test/test/bench/shootout/mandelbrot.txt diff --git a/gcc/testsuite/go.test/test/bench/meteor-contest.c b/gcc/testsuite/go.test/test/bench/shootout/meteor-contest.c index 19c43402c8c..19c43402c8c 100644 --- a/gcc/testsuite/go.test/test/bench/meteor-contest.c +++ b/gcc/testsuite/go.test/test/bench/shootout/meteor-contest.c diff --git a/gcc/testsuite/go.test/test/bench/meteor-contest.go b/gcc/testsuite/go.test/test/bench/shootout/meteor-contest.go index 6660810ebd0..34a4e23f97b 100644 --- a/gcc/testsuite/go.test/test/bench/meteor-contest.go +++ b/gcc/testsuite/go.test/test/bench/shootout/meteor-contest.go @@ -43,7 +43,6 @@ import ( var max_solutions = flag.Int("n", 2100, "maximum number of solutions") - func boolInt(b bool) int8 { if b { return 1 @@ -115,7 +114,6 @@ var piece_def = [10][4]int8{ [4]int8{E, E, E, SW}, } - /* To minimize the amount of work done in the recursive solve function below, * I'm going to allocate enough space for all legal rotations of each piece * at each position on the board. That's 10 pieces x 50 board positions x @@ -138,7 +136,6 @@ func rotate(dir int8) int8 { return (dir + 2) % PIVOT } /* Returns the direction flipped on the horizontal axis */ func flip(dir int8) int8 { return (PIVOT - dir) % PIVOT } - /* Returns the new cell index from the specified cell in the * specified direction. The index is only valid if the * starting cell and direction have been checked by the @@ -322,7 +319,6 @@ func record_piece(piece int, minimum int8, first_empty int8, piece_mask uint64) piece_counts[piece][minimum]++ } - /* Fill the entire board going cell by cell. If any cells are "trapped" * they will be left alone. */ @@ -351,7 +347,6 @@ func fill_contiguous_space(board []int8, index int8) { } } - /* To thin the number of pieces, I calculate if any of them trap any empty * cells at the edges. There are only a handful of exceptions where the * the board can be solved with the trapped cells. For example: piece 8 can @@ -382,7 +377,6 @@ func has_island(cell []int8, piece int) bool { return true } - /* Calculate all six rotations of the specified piece at the specified index. * We calculate only half of piece 3's rotations. This is because any solution * found has an identical solution rotated 180 degrees. Thus we can reduce the @@ -417,7 +411,6 @@ func calc_pieces() { } } - /* Calculate all 32 possible states for a 5-bit row and all rows that will * create islands that follow any of the 32 possible rows. These pre- * calculated 5-bit rows will be used to find islands in a partially solved @@ -530,7 +523,6 @@ func calc_rows() { } } - /* Calculate islands while solving the board. */ func boardHasIslands(cell int8) int8 { @@ -545,7 +537,6 @@ func boardHasIslands(cell int8) int8 { return bad_even_triple[current_triple] } - /* The recursive solve algorithm. Try to place each permutation in the upper- * leftmost empty cell. Mark off available pieces as it goes along. * Because the board is a bit mask, the piece number and bit mask must be saved diff --git a/gcc/testsuite/go.test/test/bench/meteor-contest.txt b/gcc/testsuite/go.test/test/bench/shootout/meteor-contest.txt index 38d9783d64f..38d9783d64f 100644 --- a/gcc/testsuite/go.test/test/bench/meteor-contest.txt +++ b/gcc/testsuite/go.test/test/bench/shootout/meteor-contest.txt diff --git a/gcc/testsuite/go.test/test/bench/nbody.c b/gcc/testsuite/go.test/test/bench/shootout/nbody.c index 3b95b05929e..3b95b05929e 100644 --- a/gcc/testsuite/go.test/test/bench/nbody.c +++ b/gcc/testsuite/go.test/test/bench/shootout/nbody.c diff --git a/gcc/testsuite/go.test/test/bench/nbody.go b/gcc/testsuite/go.test/test/bench/shootout/nbody.go index e9f4517e8e7..988f3ba9cc0 100644 --- a/gcc/testsuite/go.test/test/bench/nbody.go +++ b/gcc/testsuite/go.test/test/bench/shootout/nbody.go @@ -125,39 +125,39 @@ func (sys System) advance(dt float64) { var ( jupiter = Body{ - x: 4.84143144246472090e+00, - y: -1.16032004402742839e+00, - z: -1.03622044471123109e-01, - vx: 1.66007664274403694e-03 * daysPerYear, - vy: 7.69901118419740425e-03 * daysPerYear, - vz: -6.90460016972063023e-05 * daysPerYear, + x: 4.84143144246472090e+00, + y: -1.16032004402742839e+00, + z: -1.03622044471123109e-01, + vx: 1.66007664274403694e-03 * daysPerYear, + vy: 7.69901118419740425e-03 * daysPerYear, + vz: -6.90460016972063023e-05 * daysPerYear, mass: 9.54791938424326609e-04 * solarMass, } saturn = Body{ - x: 8.34336671824457987e+00, - y: 4.12479856412430479e+00, - z: -4.03523417114321381e-01, - vx: -2.76742510726862411e-03 * daysPerYear, - vy: 4.99852801234917238e-03 * daysPerYear, - vz: 2.30417297573763929e-05 * daysPerYear, + x: 8.34336671824457987e+00, + y: 4.12479856412430479e+00, + z: -4.03523417114321381e-01, + vx: -2.76742510726862411e-03 * daysPerYear, + vy: 4.99852801234917238e-03 * daysPerYear, + vz: 2.30417297573763929e-05 * daysPerYear, mass: 2.85885980666130812e-04 * solarMass, } uranus = Body{ - x: 1.28943695621391310e+01, - y: -1.51111514016986312e+01, - z: -2.23307578892655734e-01, - vx: 2.96460137564761618e-03 * daysPerYear, - vy: 2.37847173959480950e-03 * daysPerYear, - vz: -2.96589568540237556e-05 * daysPerYear, + x: 1.28943695621391310e+01, + y: -1.51111514016986312e+01, + z: -2.23307578892655734e-01, + vx: 2.96460137564761618e-03 * daysPerYear, + vy: 2.37847173959480950e-03 * daysPerYear, + vz: -2.96589568540237556e-05 * daysPerYear, mass: 4.36624404335156298e-05 * solarMass, } neptune = Body{ - x: 1.53796971148509165e+01, - y: -2.59193146099879641e+01, - z: 1.79258772950371181e-01, - vx: 2.68067772490389322e-03 * daysPerYear, - vy: 1.62824170038242295e-03 * daysPerYear, - vz: -9.51592254519715870e-05 * daysPerYear, + x: 1.53796971148509165e+01, + y: -2.59193146099879641e+01, + z: 1.79258772950371181e-01, + vx: 2.68067772490389322e-03 * daysPerYear, + vy: 1.62824170038242295e-03 * daysPerYear, + vz: -9.51592254519715870e-05 * daysPerYear, mass: 5.15138902046611451e-05 * solarMass, } sun = Body{ diff --git a/gcc/testsuite/go.test/test/bench/nbody.txt b/gcc/testsuite/go.test/test/bench/shootout/nbody.txt index 1731557ce19..1731557ce19 100644 --- a/gcc/testsuite/go.test/test/bench/nbody.txt +++ b/gcc/testsuite/go.test/test/bench/shootout/nbody.txt diff --git a/gcc/testsuite/go.test/test/bench/pidigits.c b/gcc/testsuite/go.test/test/bench/shootout/pidigits.c index c064da0dd20..c064da0dd20 100644 --- a/gcc/testsuite/go.test/test/bench/pidigits.c +++ b/gcc/testsuite/go.test/test/bench/shootout/pidigits.c diff --git a/gcc/testsuite/go.test/test/bench/pidigits.go b/gcc/testsuite/go.test/test/bench/shootout/pidigits.go index e59312177f4..a0f21a91db6 100644 --- a/gcc/testsuite/go.test/test/bench/pidigits.go +++ b/gcc/testsuite/go.test/test/bench/shootout/pidigits.go @@ -38,9 +38,9 @@ POSSIBILITY OF SUCH DAMAGE. package main import ( - "big" "flag" "fmt" + "math/big" ) var n = flag.Int("n", 27, "number of digits") diff --git a/gcc/testsuite/go.test/test/bench/pidigits.txt b/gcc/testsuite/go.test/test/bench/shootout/pidigits.txt index ad946a9e85d..ad946a9e85d 100644 --- a/gcc/testsuite/go.test/test/bench/pidigits.txt +++ b/gcc/testsuite/go.test/test/bench/shootout/pidigits.txt diff --git a/gcc/testsuite/go.test/test/bench/regex-dna-parallel.go b/gcc/testsuite/go.test/test/bench/shootout/regex-dna-parallel.go index 1335e4d34fd..9c6d42101d9 100644 --- a/gcc/testsuite/go.test/test/bench/regex-dna-parallel.go +++ b/gcc/testsuite/go.test/test/bench/shootout/regex-dna-parallel.go @@ -39,8 +39,8 @@ import ( "fmt" "io/ioutil" "os" - "runtime" "regexp" + "runtime" ) var variants = []string{ diff --git a/gcc/testsuite/go.test/test/bench/regex-dna-parallel.txt b/gcc/testsuite/go.test/test/bench/shootout/regex-dna-parallel.txt index e23e71fd6eb..e23e71fd6eb 100644 --- a/gcc/testsuite/go.test/test/bench/regex-dna-parallel.txt +++ b/gcc/testsuite/go.test/test/bench/shootout/regex-dna-parallel.txt diff --git a/gcc/testsuite/go.test/test/bench/regex-dna.c b/gcc/testsuite/go.test/test/bench/shootout/regex-dna.c index 134f8215c7f..134f8215c7f 100644 --- a/gcc/testsuite/go.test/test/bench/regex-dna.c +++ b/gcc/testsuite/go.test/test/bench/shootout/regex-dna.c diff --git a/gcc/testsuite/go.test/test/bench/regex-dna.go b/gcc/testsuite/go.test/test/bench/shootout/regex-dna.go index 042d7f28361..042d7f28361 100644 --- a/gcc/testsuite/go.test/test/bench/regex-dna.go +++ b/gcc/testsuite/go.test/test/bench/shootout/regex-dna.go diff --git a/gcc/testsuite/go.test/test/bench/regex-dna.txt b/gcc/testsuite/go.test/test/bench/shootout/regex-dna.txt index e23e71fd6eb..e23e71fd6eb 100644 --- a/gcc/testsuite/go.test/test/bench/regex-dna.txt +++ b/gcc/testsuite/go.test/test/bench/shootout/regex-dna.txt diff --git a/gcc/testsuite/go.test/test/bench/reverse-complement.c b/gcc/testsuite/go.test/test/bench/shootout/reverse-complement.c index b34c84696ed..b34c84696ed 100644 --- a/gcc/testsuite/go.test/test/bench/reverse-complement.c +++ b/gcc/testsuite/go.test/test/bench/shootout/reverse-complement.c diff --git a/gcc/testsuite/go.test/test/bench/reverse-complement.go b/gcc/testsuite/go.test/test/bench/shootout/reverse-complement.go index baa30ffccc8..baa30ffccc8 100644 --- a/gcc/testsuite/go.test/test/bench/reverse-complement.go +++ b/gcc/testsuite/go.test/test/bench/shootout/reverse-complement.go diff --git a/gcc/testsuite/go.test/test/bench/reverse-complement.txt b/gcc/testsuite/go.test/test/bench/shootout/reverse-complement.txt index 14d792ade8d..14d792ade8d 100644 --- a/gcc/testsuite/go.test/test/bench/reverse-complement.txt +++ b/gcc/testsuite/go.test/test/bench/shootout/reverse-complement.txt diff --git a/gcc/testsuite/go.test/test/bench/spectral-norm-parallel.go b/gcc/testsuite/go.test/test/bench/shootout/spectral-norm-parallel.go index 2706f39ec3d..2706f39ec3d 100644 --- a/gcc/testsuite/go.test/test/bench/spectral-norm-parallel.go +++ b/gcc/testsuite/go.test/test/bench/shootout/spectral-norm-parallel.go diff --git a/gcc/testsuite/go.test/test/bench/spectral-norm.c b/gcc/testsuite/go.test/test/bench/shootout/spectral-norm.c index 832eb3d2176..832eb3d2176 100644 --- a/gcc/testsuite/go.test/test/bench/spectral-norm.c +++ b/gcc/testsuite/go.test/test/bench/shootout/spectral-norm.c diff --git a/gcc/testsuite/go.test/test/bench/spectral-norm.go b/gcc/testsuite/go.test/test/bench/shootout/spectral-norm.go index 6667f3e04a5..6667f3e04a5 100644 --- a/gcc/testsuite/go.test/test/bench/spectral-norm.go +++ b/gcc/testsuite/go.test/test/bench/shootout/spectral-norm.go diff --git a/gcc/testsuite/go.test/test/bench/spectral-norm.txt b/gcc/testsuite/go.test/test/bench/shootout/spectral-norm.txt index b9885983ee4..b9885983ee4 100644 --- a/gcc/testsuite/go.test/test/bench/spectral-norm.txt +++ b/gcc/testsuite/go.test/test/bench/shootout/spectral-norm.txt diff --git a/gcc/testsuite/go.test/test/bench/threadring.c b/gcc/testsuite/go.test/test/bench/shootout/threadring.c index 2c4fb77515a..2c4fb77515a 100644 --- a/gcc/testsuite/go.test/test/bench/threadring.c +++ b/gcc/testsuite/go.test/test/bench/shootout/threadring.c diff --git a/gcc/testsuite/go.test/test/bench/threadring.go b/gcc/testsuite/go.test/test/bench/shootout/threadring.go index 031908a20f6..e76dd0b452d 100644 --- a/gcc/testsuite/go.test/test/bench/threadring.go +++ b/gcc/testsuite/go.test/test/bench/shootout/threadring.go @@ -52,7 +52,7 @@ func f(i int, in <-chan int, out chan<- int) { fmt.Printf("%d\n", i) os.Exit(0) } - out <- n-1 + out <- n - 1 } } diff --git a/gcc/testsuite/go.test/test/bench/threadring.txt b/gcc/testsuite/go.test/test/bench/shootout/threadring.txt index f9aaa4d565f..f9aaa4d565f 100644 --- a/gcc/testsuite/go.test/test/bench/threadring.txt +++ b/gcc/testsuite/go.test/test/bench/shootout/threadring.txt diff --git a/gcc/testsuite/go.test/test/bench/timing.log b/gcc/testsuite/go.test/test/bench/shootout/timing.log index 2541a766b7f..2541a766b7f 100644 --- a/gcc/testsuite/go.test/test/bench/timing.log +++ b/gcc/testsuite/go.test/test/bench/shootout/timing.log diff --git a/gcc/testsuite/go.test/test/bench/timing.sh b/gcc/testsuite/go.test/test/bench/shootout/timing.sh index 473c9b312f8..3e190e15c83 100755 --- a/gcc/testsuite/go.test/test/bench/timing.sh +++ b/gcc/testsuite/go.test/test/bench/shootout/timing.sh @@ -5,7 +5,7 @@ set -e -eval $(gomake --no-print-directory -f ../../src/Make.inc go-env) +eval $(gomake --no-print-directory -f ../../../src/Make.inc go-env) PATH=.:$PATH havegccgo=false diff --git a/gcc/testsuite/go.test/test/blank.go b/gcc/testsuite/go.test/test/blank.go index 681a5e77cb4..d6c9e79c607 100644 --- a/gcc/testsuite/go.test/test/blank.go +++ b/gcc/testsuite/go.test/test/blank.go @@ -101,6 +101,46 @@ func main() { } h(a, b) + + m() +} + +type I interface { + M(_ int, y int) +} + +type TI struct{} + +func (TI) M(x int, y int) { + if x != y { + println("invalid M call:", x, y) + panic("bad M") + } +} + +var fp = func(_ int, y int) {} + +func init() { + fp = fp1 +} + +func fp1(x, y int) { + if x != y { + println("invalid fp1 call:", x, y) + panic("bad fp1") + } +} + + +func m() { + var i I + + i = TI{} + i.M(1, 1) + i.M(2, 2) + + fp(1, 1) + fp(2, 2) } // useless but legal @@ -120,3 +160,4 @@ func _() { func ff() { var _ int = 1 } + diff --git a/gcc/testsuite/go.test/test/bugs/bug395.go b/gcc/testsuite/go.test/test/bugs/bug395.go new file mode 100644 index 00000000000..adf74497cde --- /dev/null +++ b/gcc/testsuite/go.test/test/bugs/bug395.go @@ -0,0 +1,22 @@ +// echo bug395 is broken # takes 90+ seconds to break +// # $G $D/$F.go || echo bug395 + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Issue 1909 +// Would OOM due to exponential recursion on Foo's expanded methodset in nodefmt +package test + +type Foo interface { + Bar() interface { + Foo + } + Baz() interface { + Foo + } + Bug() interface { + Foo + } +} diff --git a/gcc/testsuite/go.test/test/chan/doubleselect.go b/gcc/testsuite/go.test/test/chan/doubleselect.go index 3c7412ed6ab..f8d50c90c0f 100644 --- a/gcc/testsuite/go.test/test/chan/doubleselect.go +++ b/gcc/testsuite/go.test/test/chan/doubleselect.go @@ -82,5 +82,4 @@ func main() { // However, the result of the bug linked to at the top is that we'll // end up panicking with: "throw: bad g->status in ready". recver(cmux) - print("PASS\n") } diff --git a/gcc/testsuite/go.test/test/chan/nonblock.go b/gcc/testsuite/go.test/test/chan/nonblock.go index 33afb329165..9addf12e99a 100644 --- a/gcc/testsuite/go.test/test/chan/nonblock.go +++ b/gcc/testsuite/go.test/test/chan/nonblock.go @@ -279,5 +279,4 @@ func main() { <-sync } } - print("PASS\n") } diff --git a/gcc/testsuite/go.test/test/chan/perm.go b/gcc/testsuite/go.test/test/chan/perm.go index 038ff94e369..a43df198214 100644 --- a/gcc/testsuite/go.test/test/chan/perm.go +++ b/gcc/testsuite/go.test/test/chan/perm.go @@ -48,4 +48,11 @@ func main() { case x := <-cs: // ERROR "receive" _ = x } + + for _ = range cs {// ERROR "receive" + } + + close(c) + close(cs) + close(cr) // ERROR "receive" } diff --git a/gcc/testsuite/go.test/test/chan/select7.go b/gcc/testsuite/go.test/test/chan/select7.go new file mode 100644 index 00000000000..5fed6cbd426 --- /dev/null +++ b/gcc/testsuite/go.test/test/chan/select7.go @@ -0,0 +1,68 @@ +// $G $D/$F.go && $L $F.$A && ./$A.out + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Test select when discarding a value. + +package main + +import "runtime" + +func recv1(c <-chan int) { + <-c +} + +func recv2(c <-chan int) { + select { + case <-c: + } +} + +func recv3(c <-chan int) { + c2 := make(chan int) + select { + case <-c: + case <-c2: + } +} + +func send1(recv func(<-chan int)) { + c := make(chan int) + go recv(c) + runtime.Gosched() + c <- 1 +} + +func send2(recv func(<-chan int)) { + c := make(chan int) + go recv(c) + runtime.Gosched() + select { + case c <- 1: + } +} + +func send3(recv func(<-chan int)) { + c := make(chan int) + go recv(c) + runtime.Gosched() + c2 := make(chan int) + select { + case c <- 1: + case c2 <- 1: + } +} + +func main() { + send1(recv1) + send2(recv1) + send3(recv1) + send1(recv2) + send2(recv2) + send3(recv2) + send1(recv3) + send2(recv3) + send3(recv3) +} diff --git a/gcc/testsuite/go.test/test/closure.go b/gcc/testsuite/go.test/test/closure.go index 191514def49..97da1dd2304 100644 --- a/gcc/testsuite/go.test/test/closure.go +++ b/gcc/testsuite/go.test/test/closure.go @@ -6,6 +6,8 @@ package main +import "runtime" + var c = make(chan int) func check(a []int) { @@ -77,6 +79,8 @@ func h() { func newfunc() func(int) int { return func(x int) int { return x } } func main() { + var fail bool + go f() check([]int{1, 4, 5, 4}) @@ -88,13 +92,26 @@ func main() { go h() check([]int{100, 200, 101, 201, 500, 101, 201, 500}) + runtime.UpdateMemStats() + n0 := runtime.MemStats.Mallocs + x, y := newfunc(), newfunc() if x(1) != 1 || y(2) != 2 { println("newfunc returned broken funcs") - panic("fail") + fail = true + } + + runtime.UpdateMemStats() + if n0 != runtime.MemStats.Mallocs { + println("newfunc allocated unexpectedly") + fail = true } ff(1) + + if fail { + panic("fail") + } } func ff(x int) { diff --git a/gcc/testsuite/go.test/test/cmp.go b/gcc/testsuite/go.test/test/cmp.go new file mode 100644 index 00000000000..d51a11aa246 --- /dev/null +++ b/gcc/testsuite/go.test/test/cmp.go @@ -0,0 +1,400 @@ +// $G $D/$F.go && $L $F.$A && ./$A.out + +// Copyright 2009 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package main + +import "unsafe" + +var global bool +func use(b bool) { global = b } + +func stringptr(s string) uintptr { return *(*uintptr)(unsafe.Pointer(&s)) } + +func isfalse(b bool) { + if b { + // stack will explain where + panic("wanted false, got true") + } +} + +func istrue(b bool) { + if !b { + // stack will explain where + panic("wanted true, got false") + } +} + +type T *int + +func main() { + var a []int + var b map[string]int + + var c string = "hello" + var d string = "hel" // try to get different pointer + d = d + "lo" + if stringptr(c) == stringptr(d) { + panic("compiler too smart -- got same string") + } + + var e = make(chan int) + + var ia interface{} = a + var ib interface{} = b + var ic interface{} = c + var id interface{} = d + var ie interface{} = e + + // these comparisons are okay because + // string compare is okay and the others + // are comparisons where the types differ. + isfalse(ia == ib) + isfalse(ia == ic) + isfalse(ia == id) + isfalse(ib == ic) + isfalse(ib == id) + istrue(ic == id) + istrue(ie == ie) + + istrue(ia != ib) + istrue(ia != ic) + istrue(ia != id) + istrue(ib != ic) + istrue(ib != id) + isfalse(ic != id) + isfalse(ie != ie) + + // these are not okay, because there is no comparison on slices or maps. + //isfalse(a == ib) + //isfalse(a == ic) + //isfalse(a == id) + //isfalse(b == ic) + //isfalse(b == id) + + istrue(c == id) + istrue(e == ie) + + //isfalse(ia == b) + isfalse(ia == c) + isfalse(ia == d) + isfalse(ib == c) + isfalse(ib == d) + istrue(ic == d) + istrue(ie == e) + + //istrue(a != ib) + //istrue(a != ic) + //istrue(a != id) + //istrue(b != ic) + //istrue(b != id) + isfalse(c != id) + isfalse(e != ie) + + //istrue(ia != b) + istrue(ia != c) + istrue(ia != d) + istrue(ib != c) + istrue(ib != d) + isfalse(ic != d) + isfalse(ie != e) + + // 6g used to let this go through as true. + var g uint64 = 123 + var h int64 = 123 + var ig interface{} = g + var ih interface{} = h + isfalse(ig == ih) + istrue(ig != ih) + + // map of interface should use == on interface values, + // not memory. + var m = make(map[interface{}]int) + m[ic] = 1 + m[id] = 2 + if m[c] != 2 { + println("m[c] = ", m[c]) + panic("bad m[c]") + } + + // non-interface comparisons + { + c := make(chan int) + c1 := (<-chan int)(c) + c2 := (chan<- int)(c) + istrue(c == c1) + istrue(c == c2) + istrue(c1 == c) + istrue(c2 == c) + + isfalse(c != c1) + isfalse(c != c2) + isfalse(c1 != c) + isfalse(c2 != c) + + d := make(chan int) + isfalse(c == d) + isfalse(d == c) + isfalse(d == c1) + isfalse(d == c2) + isfalse(c1 == d) + isfalse(c2 == d) + + istrue(c != d) + istrue(d != c) + istrue(d != c1) + istrue(d != c2) + istrue(c1 != d) + istrue(c2 != d) + } + + // named types vs not + { + var x = new(int) + var y T + var z T = x + + isfalse(x == y) + istrue(x == z) + isfalse(y == z) + + isfalse(y == x) + istrue(z == x) + isfalse(z == y) + + istrue(x != y) + isfalse(x != z) + istrue(y != z) + + istrue(y != x) + isfalse(z != x) + istrue(z != y) + } + + // structs + { + var x = struct { + x int + y string + }{1, "hi"} + var y = struct { + x int + y string + }{2, "bye"} + var z = struct { + x int + y string + }{1, "hi"} + + isfalse(x == y) + isfalse(y == x) + isfalse(y == z) + isfalse(z == y) + istrue(x == z) + istrue(z == x) + + istrue(x != y) + istrue(y != x) + istrue(y != z) + istrue(z != y) + isfalse(x != z) + isfalse(z != x) + + var m = make(map[struct { + x int + y string + }]int) + m[x] = 10 + m[y] = 20 + m[z] = 30 + istrue(m[x] == 30) + istrue(m[y] == 20) + istrue(m[z] == 30) + istrue(m[x] != 10) + isfalse(m[x] != 30) + isfalse(m[y] != 20) + isfalse(m[z] != 30) + isfalse(m[x] == 10) + + var m1 = make(map[struct { + x int + y string + }]struct { + x int + y string + }) + m1[x] = x + m1[y] = y + m1[z] = z + istrue(m1[x] == z) + istrue(m1[y] == y) + istrue(m1[z] == z) + istrue(m1[x] == x) + isfalse(m1[x] != z) + isfalse(m1[y] != y) + isfalse(m1[z] != z) + isfalse(m1[x] != x) + + var ix, iy, iz interface{} = x, y, z + + isfalse(ix == iy) + isfalse(iy == ix) + isfalse(iy == iz) + isfalse(iz == iy) + istrue(ix == iz) + istrue(iz == ix) + + isfalse(x == iy) + isfalse(y == ix) + isfalse(y == iz) + isfalse(z == iy) + istrue(x == iz) + istrue(z == ix) + + isfalse(ix == y) + isfalse(iy == x) + isfalse(iy == z) + isfalse(iz == y) + istrue(ix == z) + istrue(iz == x) + + istrue(ix != iy) + istrue(iy != ix) + istrue(iy != iz) + istrue(iz != iy) + isfalse(ix != iz) + isfalse(iz != ix) + + istrue(x != iy) + istrue(y != ix) + istrue(y != iz) + istrue(z != iy) + isfalse(x != iz) + isfalse(z != ix) + + istrue(ix != y) + istrue(iy != x) + istrue(iy != z) + istrue(iz != y) + isfalse(ix != z) + isfalse(iz != x) + } + + // arrays + { + var x = [2]string{"1", "hi"} + var y = [2]string{"2", "bye"} + var z = [2]string{"1", "hi"} + + isfalse(x == y) + isfalse(y == x) + isfalse(y == z) + isfalse(z == y) + istrue(x == z) + istrue(z == x) + + istrue(x != y) + istrue(y != x) + istrue(y != z) + istrue(z != y) + isfalse(x != z) + isfalse(z != x) + + var m = make(map[[2]string]int) + m[x] = 10 + m[y] = 20 + m[z] = 30 + istrue(m[x] == 30) + istrue(m[y] == 20) + istrue(m[z] == 30) + isfalse(m[x] != 30) + isfalse(m[y] != 20) + isfalse(m[z] != 30) + + var ix, iy, iz interface{} = x, y, z + + isfalse(ix == iy) + isfalse(iy == ix) + isfalse(iy == iz) + isfalse(iz == iy) + istrue(ix == iz) + istrue(iz == ix) + + isfalse(x == iy) + isfalse(y == ix) + isfalse(y == iz) + isfalse(z == iy) + istrue(x == iz) + istrue(z == ix) + + isfalse(ix == y) + isfalse(iy == x) + isfalse(iy == z) + isfalse(iz == y) + istrue(ix == z) + istrue(iz == x) + + istrue(ix != iy) + istrue(iy != ix) + istrue(iy != iz) + istrue(iz != iy) + isfalse(ix != iz) + isfalse(iz != ix) + + istrue(x != iy) + istrue(y != ix) + istrue(y != iz) + istrue(z != iy) + isfalse(x != iz) + isfalse(z != ix) + + istrue(ix != y) + istrue(iy != x) + istrue(iy != z) + istrue(iz != y) + isfalse(ix != z) + isfalse(iz != x) + } + + shouldPanic(p1) + shouldPanic(p2) + shouldPanic(p3) + shouldPanic(p4) +} + +func p1() { + var a []int + var ia interface{} = a + use(ia == ia) +} + +func p2() { + var b []int + var ib interface{} = b + use(ib == ib) +} + +func p3() { + var a []int + var ia interface{} = a + var m = make(map[interface{}]int) + m[ia] = 1 +} + +func p4() { + var b []int + var ib interface{} = b + var m = make(map[interface{}]int) + m[ib] = 1 +} + +func shouldPanic(f func()) { + defer func() { + if recover() == nil { + panic("function should panic") + } + }() + f() +} diff --git a/gcc/testsuite/go.test/test/cmp3.go b/gcc/testsuite/go.test/test/cmp3.go deleted file mode 100644 index dd90bfb03e0..00000000000 --- a/gcc/testsuite/go.test/test/cmp3.go +++ /dev/null @@ -1,15 +0,0 @@ -// $G $D/$F.go && $L $F.$A && ! ./$A.out - -// Copyright 2009 The Go Authors. All rights reserved. -// Use of this source code is governed by a BSD-style -// license that can be found in the LICENSE file. - -package main - -func use(bool) { } - -func main() { - var b []int - var ib interface{} = b - use(ib == ib) -} diff --git a/gcc/testsuite/go.test/test/cmp4.go b/gcc/testsuite/go.test/test/cmp4.go deleted file mode 100644 index 3f9b2c0b8b6..00000000000 --- a/gcc/testsuite/go.test/test/cmp4.go +++ /dev/null @@ -1,14 +0,0 @@ -// $G $D/$F.go && $L $F.$A && ! ./$A.out - -// Copyright 2009 The Go Authors. All rights reserved. -// Use of this source code is governed by a BSD-style -// license that can be found in the LICENSE file. - -package main - -func main() { - var a []int - var ia interface{} = a - var m = make(map[interface{}] int) - m[ia] = 1 -} diff --git a/gcc/testsuite/go.test/test/cmp5.go b/gcc/testsuite/go.test/test/cmp5.go deleted file mode 100644 index 3a7d733f024..00000000000 --- a/gcc/testsuite/go.test/test/cmp5.go +++ /dev/null @@ -1,14 +0,0 @@ -// $G $D/$F.go && $L $F.$A && ! ./$A.out - -// Copyright 2009 The Go Authors. All rights reserved. -// Use of this source code is governed by a BSD-style -// license that can be found in the LICENSE file. - -package main - -func main() { - var b []int - var ib interface{} = b - var m = make(map[interface{}] int) - m[ib] = 1 -} diff --git a/gcc/testsuite/go.test/test/complit.go b/gcc/testsuite/go.test/test/complit.go index f5f7aca9d90..8dfc71dcb47 100644 --- a/gcc/testsuite/go.test/test/complit.go +++ b/gcc/testsuite/go.test/test/complit.go @@ -31,6 +31,18 @@ func eq(a []*R) { } } +func teq(t *T, n int) { + for i := 0; i < n; i++ { + if t == nil || t.i != i { + panic("bad") + } + t = t.next + } + if t != nil { + panic("bad") + } +} + type P struct { a, b int } @@ -46,6 +58,9 @@ func main() { var tp *T tp = &T{0, 7.2, "hi", &t} + tl := &T{i: 0, next: &T{i: 1, next: &T{i: 2, next: &T{i: 3, next: &T{i: 4}}}}} + teq(tl, 5) + a1 := []int{1, 2, 3} if len(a1) != 3 { panic("a1") @@ -93,6 +108,7 @@ func main() { } eq([]*R{itor(0), itor(1), itor(2), itor(3), itor(4), itor(5)}) + eq([]*R{{0}, {1}, {2}, {3}, {4}, {5}}) p1 := NewP(1, 2) p2 := NewP(1, 2) diff --git a/gcc/testsuite/go.test/test/complit1.go b/gcc/testsuite/go.test/test/complit1.go new file mode 100644 index 00000000000..cd543930eef --- /dev/null +++ b/gcc/testsuite/go.test/test/complit1.go @@ -0,0 +1,39 @@ +// errchk $G -e $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package main + +var m map[int][3]int + +func f() [3]int + +func fp() *[3]int + +var mp map[int]*[3]int + +var ( + _ = [3]int{1, 2, 3}[:] // ERROR "slice of unaddressable value" + _ = m[0][:] // ERROR "slice of unaddressable value" + _ = f()[:] // ERROR "slice of unaddressable value" + + // these are okay because they are slicing a pointer to an array + _ = (&[3]int{1, 2, 3})[:] + _ = mp[0][:] + _ = fp()[:] +) + +type T struct { + i int + f float64 + s string + next *T +} + +var ( + _ = &T{0, 0, "", nil} // ok + _ = &T{i: 0, f: 0, s: "", next: {}} // ERROR "missing type in composite literal|omit types within composite literal" + _ = &T{0, 0, "", {}} // ERROR "missing type in composite literal|omit types within composite literal" +) diff --git a/gcc/testsuite/go.test/test/convert1.go b/gcc/testsuite/go.test/test/convert1.go new file mode 100644 index 00000000000..bbd0c5f2b06 --- /dev/null +++ b/gcc/testsuite/go.test/test/convert1.go @@ -0,0 +1,96 @@ +// errchk $G -e $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package main + +type Tbyte []byte +type Trune []rune +type Tint64 []int64 +type Tstring string + +func main() { + s := "hello" + sb := []byte("hello") + sr := []rune("hello") + si := []int64{'h', 'e', 'l', 'l', 'o'} + + ts := Tstring(s) + tsb := Tbyte(sb) + tsr := Trune(sr) + tsi := Tint64(si) + + _ = string(s) + _ = []byte(s) + _ = []rune(s) + _ = []int64(s) // ERROR "cannot convert.*\[\]int64|invalid type conversion" + _ = Tstring(s) + _ = Tbyte(s) + _ = Trune(s) + _ = Tint64(s) // ERROR "cannot convert.*Tint64|invalid type conversion" + + _ = string(sb) + _ = []byte(sb) + _ = []rune(sb) // ERROR "cannot convert.*\[\]rune|invalid type conversion" + _ = []int64(sb) // ERROR "cannot convert.*\[\]int64|invalid type conversion" + _ = Tstring(sb) + _ = Tbyte(sb) + _ = Trune(sb) // ERROR "cannot convert.*Trune|invalid type conversion" + _ = Tint64(sb) // ERROR "cannot convert.*Tint64|invalid type conversion" + + _ = string(sr) + _ = []byte(sr) // ERROR "cannot convert.*\[\]byte|invalid type conversion" + _ = []rune(sr) + _ = []int64(sr) // ERROR "cannot convert.*\[\]int64|invalid type conversion" + _ = Tstring(sr) + _ = Tbyte(sr) // ERROR "cannot convert.*Tbyte|invalid type conversion" + _ = Trune(sr) + _ = Tint64(sr) // ERROR "cannot convert.*Tint64|invalid type conversion" + + _ = string(si) // ERROR "cannot convert.* string|invalid type conversion" + _ = []byte(si) // ERROR "cannot convert.*\[\]byte|invalid type conversion" + _ = []rune(si) // ERROR "cannot convert.*\[\]rune|invalid type conversion" + _ = []int64(si) + _ = Tstring(si) // ERROR "cannot convert.*Tstring|invalid type conversion" + _ = Tbyte(si) // ERROR "cannot convert.*Tbyte|invalid type conversion" + _ = Trune(si) // ERROR "cannot convert.*Trune|invalid type conversion" + _ = Tint64(si) + + _ = string(ts) + _ = []byte(ts) + _ = []rune(ts) + _ = []int64(ts) // ERROR "cannot convert.*\[\]int64|invalid type conversion" + _ = Tstring(ts) + _ = Tbyte(ts) + _ = Trune(ts) + _ = Tint64(ts) // ERROR "cannot convert.*Tint64|invalid type conversion" + + _ = string(tsb) + _ = []byte(tsb) + _ = []rune(tsb) // ERROR "cannot convert.*\[\]rune|invalid type conversion" + _ = []int64(tsb) // ERROR "cannot convert.*\[\]int64|invalid type conversion" + _ = Tstring(tsb) + _ = Tbyte(tsb) + _ = Trune(tsb) // ERROR "cannot convert.*Trune|invalid type conversion" + _ = Tint64(tsb) // ERROR "cannot convert.*Tint64|invalid type conversion" + + _ = string(tsr) + _ = []byte(tsr) // ERROR "cannot convert.*\[\]byte|invalid type conversion" + _ = []rune(tsr) + _ = []int64(tsr) // ERROR "cannot convert.*\[\]int64|invalid type conversion" + _ = Tstring(tsr) + _ = Tbyte(tsr) // ERROR "cannot convert.*Tbyte|invalid type conversion" + _ = Trune(tsr) + _ = Tint64(tsr) // ERROR "cannot convert.*Tint64|invalid type conversion" + + _ = string(tsi) // ERROR "cannot convert.* string|invalid type conversion" + _ = []byte(tsi) // ERROR "cannot convert.*\[\]byte|invalid type conversion" + _ = []rune(tsi) // ERROR "cannot convert.*\[\]rune|invalid type conversion" + _ = []int64(tsi) + _ = Tstring(tsi) // ERROR "cannot convert.*Tstring|invalid type conversion" + _ = Tbyte(tsi) // ERROR "cannot convert.*Tbyte|invalid type conversion" + _ = Trune(tsi) // ERROR "cannot convert.*Trune|invalid type conversion" + _ = Tint64(tsi) +} diff --git a/gcc/testsuite/go.test/test/crlf.go b/gcc/testsuite/go.test/test/crlf.go new file mode 100644 index 00000000000..292b63bf4b3 --- /dev/null +++ b/gcc/testsuite/go.test/test/crlf.go @@ -0,0 +1,52 @@ +// $G $D/$F.go && $L $F.$A && ./$A.out >tmp.go && +// $G tmp.go && $L tmp.$A && ./$A.out +// rm -f tmp.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Test source files and strings containing \r and \r\n. + +package main + +import ( + "fmt" + "strings" +) + +func main() { + prog = strings.Replace(prog, "BQ", "`", -1) + prog = strings.Replace(prog, "CR", "\r", -1) + fmt.Print(prog) +} + +var prog = ` +package main +CR + +import "fmt" + +var CR s = "hello\n" + CR + " world"CR + +var t = BQhelloCR + worldBQ + +var u = BQhCReCRlCRlCRoCR + worldBQ + +var golden = "hello\n world" + +func main() { + if s != golden { + fmt.Printf("s=%q, want %q", s, golden) + } + if t != golden { + fmt.Printf("t=%q, want %q", t, golden) + } + if u != golden { + fmt.Printf("u=%q, want %q", u, golden) + } +} +` diff --git a/gcc/testsuite/go.test/test/ddd1.go b/gcc/testsuite/go.test/test/ddd1.go index 83e32de7b6b..6d84248e5e8 100644 --- a/gcc/testsuite/go.test/test/ddd1.go +++ b/gcc/testsuite/go.test/test/ddd1.go @@ -15,8 +15,8 @@ var ( _ = sum() _ = sum(1.0, 2.0) _ = sum(1.5) // ERROR "integer" - _ = sum("hello") // ERROR "string.*as type int|incompatible" - _ = sum([]int{1}) // ERROR "slice literal.*as type int|incompatible" + _ = sum("hello") // ERROR ".hello. .type string. as type int|incompatible" + _ = sum([]int{1}) // ERROR "\[\]int literal.*as type int|incompatible" ) type T []T diff --git a/gcc/testsuite/go.test/test/deferprint.go b/gcc/testsuite/go.test/test/deferprint.go index f1e75266f78..0e0c6182168 100644 --- a/gcc/testsuite/go.test/test/deferprint.go +++ b/gcc/testsuite/go.test/test/deferprint.go @@ -1,4 +1,4 @@ -// $G $D/$F.go && $L $F.$A && ./$A.out +// $G $D/$F.go && $L $F.$A && ./$A.out 2>&1 | cmp - $D/$F.out // Copyright 2010 The Go Authors. All rights reserved. // Use of this source code is governed by a BSD-style diff --git a/gcc/testsuite/go.test/test/deferprint.out b/gcc/testsuite/go.test/test/deferprint.out new file mode 100644 index 00000000000..a71cfcebd7e --- /dev/null +++ b/gcc/testsuite/go.test/test/deferprint.out @@ -0,0 +1,2 @@ +printing: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 +42 true false true +1.500000e+000 world 0x0 [0/0]0x0 0x0 0x0 255 diff --git a/gcc/testsuite/go.test/test/dwarf/linedirectives.go b/gcc/testsuite/go.test/test/dwarf/linedirectives.go new file mode 100644 index 00000000000..68434f0ab57 --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/linedirectives.go @@ -0,0 +1,83 @@ +// $G $D/$F.go && $L $F.$A && ./$A.out + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +//line foo/bar.y:4 +package main +//line foo/bar.y:60 +func main() { +//line foo/bar.y:297 + f, l := 0, 0 +//line yacctab:1 + f, l = 1, 1 +//line yaccpar:1 + f, l = 2, 1 +//line foo/bar.y:82 + f, l = 3, 82 +//line foo/bar.y:90 + f, l = 3, 90 +//line foo/bar.y:92 + f, l = 3, 92 +//line foo/bar.y:100 + f, l = 3, 100 +//line foo/bar.y:104 + l = 104 +//line foo/bar.y:112 + l = 112 +//line foo/bar.y:117 + l = 117 +//line foo/bar.y:121 + l = 121 +//line foo/bar.y:125 + l = 125 +//line foo/bar.y:133 + l = 133 +//line foo/bar.y:146 + l = 146 +//line foo/bar.y:148 +//line foo/bar.y:153 +//line foo/bar.y:155 + l = 155 +//line foo/bar.y:160 + +//line foo/bar.y:164 +//line foo/bar.y:173 + +//line foo/bar.y:178 +//line foo/bar.y:180 +//line foo/bar.y:185 +//line foo/bar.y:195 +//line foo/bar.y:197 +//line foo/bar.y:202 +//line foo/bar.y:204 +//line foo/bar.y:208 +//line foo/bar.y:211 +//line foo/bar.y:213 +//line foo/bar.y:215 +//line foo/bar.y:217 +//line foo/bar.y:221 +//line foo/bar.y:229 +//line foo/bar.y:236 +//line foo/bar.y:238 +//line foo/bar.y:240 +//line foo/bar.y:244 +//line foo/bar.y:249 +//line foo/bar.y:253 +//line foo/bar.y:257 +//line foo/bar.y:262 +//line foo/bar.y:267 +//line foo/bar.y:272 + if l == f { +//line foo/bar.y:277 + panic("aie!") +//line foo/bar.y:281 + } +//line foo/bar.y:285 + return +//line foo/bar.y:288 +//line foo/bar.y:290 +} +//line foo/bar.y:293 +//line foo/bar.y:295 diff --git a/gcc/testsuite/go.test/test/cmp2.go b/gcc/testsuite/go.test/test/dwarf/main.go index f6f124f2e8a..7f2ec4c00a6 100644 --- a/gcc/testsuite/go.test/test/cmp2.go +++ b/gcc/testsuite/go.test/test/dwarf/main.go @@ -1,15 +1,29 @@ -// $G $D/$F.go && $L $F.$A && ! ./$A.out +// $G $D/$F.go $D/z*.go && $L $F.$A && ./$A.out // Copyright 2009 The Go Authors. All rights reserved. // Use of this source code is governed by a BSD-style // license that can be found in the LICENSE file. package main - -func use(bool) { } - func main() { - var a []int - var ia interface{} = a - use(ia == ia) +F1() +F2() +F3() +F4() +F5() +F6() +F7() +F8() +F9() +F10() +F11() +F12() +F13() +F14() +F15() +F16() +F17() +F18() +F19() +F20() } diff --git a/gcc/testsuite/go.test/test/dwarf/z1.go b/gcc/testsuite/go.test/test/dwarf/z1.go new file mode 100644 index 00000000000..7f163e9a1d9 --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/z1.go @@ -0,0 +1,5 @@ + + +//line x1.go:4 +package main +func F1() {} diff --git a/gcc/testsuite/go.test/test/dwarf/z10.go b/gcc/testsuite/go.test/test/dwarf/z10.go new file mode 100644 index 00000000000..19c70020e0c --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/z10.go @@ -0,0 +1,6 @@ + + + +//line x10.go:4 +package main +func F10() {} diff --git a/gcc/testsuite/go.test/test/dwarf/z11.go b/gcc/testsuite/go.test/test/dwarf/z11.go new file mode 100644 index 00000000000..c1d2f9180f1 --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/z11.go @@ -0,0 +1,4 @@ + +//line x11.go:4 +package main +func F11() {} diff --git a/gcc/testsuite/go.test/test/dwarf/z12.go b/gcc/testsuite/go.test/test/dwarf/z12.go new file mode 100644 index 00000000000..7455f189468 --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/z12.go @@ -0,0 +1,4 @@ + +//line x12.go:4 +package main +func F12() {} diff --git a/gcc/testsuite/go.test/test/dwarf/z13.go b/gcc/testsuite/go.test/test/dwarf/z13.go new file mode 100644 index 00000000000..ecb3c4c8c71 --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/z13.go @@ -0,0 +1,4 @@ + +//line x13.go:4 +package main +func F13() {} diff --git a/gcc/testsuite/go.test/test/dwarf/z14.go b/gcc/testsuite/go.test/test/dwarf/z14.go new file mode 100644 index 00000000000..134b39b64e2 --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/z14.go @@ -0,0 +1,4 @@ + +//line x14.go:4 +package main +func F14() {} diff --git a/gcc/testsuite/go.test/test/dwarf/z15.go b/gcc/testsuite/go.test/test/dwarf/z15.go new file mode 100644 index 00000000000..d73819b443b --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/z15.go @@ -0,0 +1,4 @@ + +//line x15.go:4 +package main +func F15() {} diff --git a/gcc/testsuite/go.test/test/dwarf/z16.go b/gcc/testsuite/go.test/test/dwarf/z16.go new file mode 100644 index 00000000000..6c31651baa8 --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/z16.go @@ -0,0 +1,4 @@ + +//line x16.go:4 +package main +func F16() {} diff --git a/gcc/testsuite/go.test/test/dwarf/z17.go b/gcc/testsuite/go.test/test/dwarf/z17.go new file mode 100644 index 00000000000..b742d167260 --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/z17.go @@ -0,0 +1,4 @@ + +//line x17.go:4 +package main +func F17() {} diff --git a/gcc/testsuite/go.test/test/dwarf/z18.go b/gcc/testsuite/go.test/test/dwarf/z18.go new file mode 100644 index 00000000000..84150ff0a35 --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/z18.go @@ -0,0 +1,5 @@ + + +//line x18.go:4 +package main +func F18() {} diff --git a/gcc/testsuite/go.test/test/dwarf/z19.go b/gcc/testsuite/go.test/test/dwarf/z19.go new file mode 100644 index 00000000000..bb2e2968417 --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/z19.go @@ -0,0 +1,4 @@ + +//line x19.go:4 +package main +func F19() {} diff --git a/gcc/testsuite/go.test/test/dwarf/z2.go b/gcc/testsuite/go.test/test/dwarf/z2.go new file mode 100644 index 00000000000..68bd58257d9 --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/z2.go @@ -0,0 +1,4 @@ + +//line x2.go:4 +package main +func F2() {} diff --git a/gcc/testsuite/go.test/test/dwarf/z20.go b/gcc/testsuite/go.test/test/dwarf/z20.go new file mode 100644 index 00000000000..03111e18452 --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/z20.go @@ -0,0 +1,4 @@ + +//line x20.go:4 +package main +func F20() {} diff --git a/gcc/testsuite/go.test/test/dwarf/z3.go b/gcc/testsuite/go.test/test/dwarf/z3.go new file mode 100644 index 00000000000..5e4ad3ae257 --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/z3.go @@ -0,0 +1,4 @@ + +//line x3.go:4 +package main +func F3() {} diff --git a/gcc/testsuite/go.test/test/dwarf/z4.go b/gcc/testsuite/go.test/test/dwarf/z4.go new file mode 100644 index 00000000000..1f28465c577 --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/z4.go @@ -0,0 +1,4 @@ + +//line x4.go:4 +package main +func F4() {} diff --git a/gcc/testsuite/go.test/test/dwarf/z5.go b/gcc/testsuite/go.test/test/dwarf/z5.go new file mode 100644 index 00000000000..7f4eeb419a3 --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/z5.go @@ -0,0 +1,4 @@ + +//line x5.go:4 +package main +func F5() {} diff --git a/gcc/testsuite/go.test/test/dwarf/z6.go b/gcc/testsuite/go.test/test/dwarf/z6.go new file mode 100644 index 00000000000..241791dff2b --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/z6.go @@ -0,0 +1,4 @@ + +//line x6.go:4 +package main +func F6() {} diff --git a/gcc/testsuite/go.test/test/dwarf/z7.go b/gcc/testsuite/go.test/test/dwarf/z7.go new file mode 100644 index 00000000000..68c1ad0c243 --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/z7.go @@ -0,0 +1,4 @@ + +//line x7.go:4 +package main +func F7() {} diff --git a/gcc/testsuite/go.test/test/dwarf/z8.go b/gcc/testsuite/go.test/test/dwarf/z8.go new file mode 100644 index 00000000000..16eed32a28d --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/z8.go @@ -0,0 +1,4 @@ + +//line x8.go:4 +package main +func F8() {} diff --git a/gcc/testsuite/go.test/test/dwarf/z9.go b/gcc/testsuite/go.test/test/dwarf/z9.go new file mode 100644 index 00000000000..cbb94b4d2be --- /dev/null +++ b/gcc/testsuite/go.test/test/dwarf/z9.go @@ -0,0 +1,4 @@ + +//line x9.go:4 +package main +func F9() {} diff --git a/gcc/testsuite/go.test/test/escape2.go b/gcc/testsuite/go.test/test/escape2.go new file mode 100644 index 00000000000..73b2a7e5897 --- /dev/null +++ b/gcc/testsuite/go.test/test/escape2.go @@ -0,0 +1,1064 @@ +// errchk -0 $G -m -l $D/$F.go + +// Copyright 2010 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package foo + +import ( + "fmt" + "unsafe" +) + +var gxx *int + +func foo1(x int) { // ERROR "moved to heap: x" + gxx = &x // ERROR "&x escapes to heap" +} + +func foo2(yy *int) { // ERROR "leaking param: yy" + gxx = yy +} + +func foo3(x int) *int { // ERROR "moved to heap: x" + return &x // ERROR "&x escapes to heap" +} + +type T *T + +func foo3b(t T) { // ERROR "leaking param: t" + *t = t +} + +// xx isn't going anywhere, so use of yy is ok +func foo4(xx, yy *int) { // ERROR "xx does not escape" "yy does not escape" + xx = yy +} + +// xx isn't going anywhere, so taking address of yy is ok +func foo5(xx **int, yy *int) { // ERROR "xx does not escape" "yy does not escape" + xx = &yy // ERROR "&yy does not escape" +} + +func foo6(xx **int, yy *int) { // ERROR "xx does not escape" "leaking param: yy" + *xx = yy +} + +func foo7(xx **int, yy *int) { // ERROR "xx does not escape" "yy does not escape" + **xx = *yy +} + +func foo8(xx, yy *int) int { // ERROR "xx does not escape" "yy does not escape" + xx = yy + return *xx +} + +func foo9(xx, yy *int) *int { // ERROR "leaking param: xx" "leaking param: yy" + xx = yy + return xx +} + +func foo10(xx, yy *int) { // ERROR "xx does not escape" "yy does not escape" + *xx = *yy +} + +func foo11() int { + x, y := 0, 42 + xx := &x // ERROR "&x does not escape" + yy := &y // ERROR "&y does not escape" + *xx = *yy + return x +} + +var xxx **int + +func foo12(yyy **int) { // ERROR "leaking param: yyy" + xxx = yyy +} + +func foo13(yyy **int) { // ERROR "yyy does not escape" + *xxx = *yyy +} + +func foo14(yyy **int) { // ERROR "yyy does not escape" + **xxx = **yyy +} + +func foo15(yy *int) { // ERROR "moved to heap: yy" + xxx = &yy // ERROR "&yy escapes to heap" +} + +func foo16(yy *int) { // ERROR "leaking param: yy" + *xxx = yy +} + +func foo17(yy *int) { // ERROR "yy does not escape" + **xxx = *yy +} + +func foo18(y int) { // ERROR "moved to heap: "y" + *xxx = &y // ERROR "&y escapes to heap" +} + +func foo19(y int) { + **xxx = y +} + +type Bar struct { + i int + ii *int +} + +func NewBar() *Bar { + return &Bar{42, nil} // ERROR "&Bar literal escapes to heap" +} + +func NewBarp(x *int) *Bar { // ERROR "leaking param: x" + return &Bar{42, x} // ERROR "&Bar literal escapes to heap" +} + +func NewBarp2(x *int) *Bar { // ERROR "x does not escape" + return &Bar{*x, nil} // ERROR "&Bar literal escapes to heap" +} + +func (b *Bar) NoLeak() int { // ERROR "b does not escape" + return *(b.ii) +} + +func (b *Bar) Leak() *int { // ERROR "leaking param: b" + return &b.i // ERROR "&b.i escapes to heap" +} + +func (b *Bar) AlsoNoLeak() *int { // ERROR "b does not escape" + return b.ii +} + +func (b Bar) AlsoLeak() *int { // ERROR "leaking param: b" + return b.ii +} + +func (b Bar) LeaksToo() *int { // ERROR "leaking param: b" + v := 0 // ERROR "moved to heap: v" + b.ii = &v // ERROR "&v escapes" + return b.ii +} + +func (b *Bar) LeaksABit() *int { // ERROR "b does not escape" + v := 0 // ERROR "moved to heap: v" + b.ii = &v // ERROR "&v escapes" + return b.ii +} + +func (b Bar) StillNoLeak() int { // ERROR "b does not escape" + v := 0 + b.ii = &v // ERROR "&v does not escape" + return b.i +} + +func goLeak(b *Bar) { // ERROR "leaking param: b" + go b.NoLeak() +} + +type Bar2 struct { + i [12]int + ii []int +} + +func NewBar2() *Bar2 { + return &Bar2{[12]int{42}, nil} // ERROR "&Bar2 literal escapes to heap" +} + +func (b *Bar2) NoLeak() int { // ERROR "b does not escape" + return b.i[0] +} + +func (b *Bar2) Leak() []int { // ERROR "leaking param: b" + return b.i[:] // ERROR "b.i escapes to heap" +} + +func (b *Bar2) AlsoNoLeak() []int { // ERROR "b does not escape" + return b.ii[0:1] +} + +func (b Bar2) AgainNoLeak() [12]int { // ERROR "b does not escape" + return b.i +} + +func (b *Bar2) LeakSelf() { // ERROR "leaking param: b" + b.ii = b.i[0:4] // ERROR "b.i escapes to heap" +} + +func (b *Bar2) LeakSelf2() { // ERROR "leaking param: b" + var buf []int + buf = b.i[0:] // ERROR "b.i escapes to heap" + b.ii = buf +} + +func foo21() func() int { + x := 42 // ERROR "moved to heap: x" + return func() int { // ERROR "func literal escapes to heap" + return x // ERROR "&x escapes to heap" + } +} + +func foo22() int { + x := 42 + return func() int { // ERROR "func literal does not escape" + return x + }() +} + +func foo23(x int) func() int { // ERROR "moved to heap: x" + return func() int { // ERROR "func literal escapes to heap" + return x // ERROR "&x escapes to heap" + } +} + +func foo23a(x int) func() int { // ERROR "moved to heap: x" + f := func() int { // ERROR "func literal escapes to heap" + return x // ERROR "&x escapes to heap" + } + return f +} + +func foo23b(x int) *(func() int) { // ERROR "moved to heap: x" + f := func() int { return x } // ERROR "moved to heap: f" "func literal escapes to heap" "&x escapes to heap" + return &f // ERROR "&f escapes to heap" +} + +func foo24(x int) int { + return func() int { // ERROR "func literal does not escape" + return x + }() +} + +var x *int + +func fooleak(xx *int) int { // ERROR "leaking param: xx" + x = xx + return *x +} + +func foonoleak(xx *int) int { // ERROR "xx does not escape" + return *x + *xx +} + +func foo31(x int) int { // ERROR "moved to heap: x" + return fooleak(&x) // ERROR "&x escapes to heap" +} + +func foo32(x int) int { + return foonoleak(&x) // ERROR "&x does not escape" +} + +type Foo struct { + xx *int + x int +} + +var F Foo +var pf *Foo + +func (f *Foo) fooleak() { // ERROR "leaking param: f" + pf = f +} + +func (f *Foo) foonoleak() { // ERROR "f does not escape" + F.x = f.x +} + +func (f *Foo) Leak() { // ERROR "leaking param: f" + f.fooleak() +} + +func (f *Foo) NoLeak() { // ERROR "f does not escape" + f.foonoleak() +} + +func foo41(x int) { // ERROR "moved to heap: x" + F.xx = &x // ERROR "&x escapes to heap" +} + +func (f *Foo) foo42(x int) { // ERROR "f does not escape" "moved to heap: x" + f.xx = &x // ERROR "&x escapes to heap" +} + +func foo43(f *Foo, x int) { // ERROR "f does not escape" "moved to heap: x" + f.xx = &x // ERROR "&x escapes to heap" +} + +func foo44(yy *int) { // ERROR "leaking param: yy" + F.xx = yy +} + +func (f *Foo) foo45() { // ERROR "f does not escape" + F.x = f.x +} + +func (f *Foo) foo46() { // ERROR "f does not escape" + F.xx = f.xx +} + +func (f *Foo) foo47() { // ERROR "leaking param: f" + f.xx = &f.x // ERROR "&f.x escapes to heap" +} + +var ptrSlice []*int + +func foo50(i *int) { // ERROR "leaking param: i" + ptrSlice[0] = i +} + +var ptrMap map[*int]*int + +func foo51(i *int) { // ERROR "leaking param: i" + ptrMap[i] = i +} + +func indaddr1(x int) *int { // ERROR "moved to heap: x" + return &x // ERROR "&x escapes to heap" +} + +func indaddr2(x *int) *int { // ERROR "leaking param: x" + return *&x // ERROR "&x does not escape" +} + +func indaddr3(x *int32) *int { // ERROR "leaking param: x" + return *(**int)(unsafe.Pointer(&x)) // ERROR "&x does not escape" +} + +// From package math: + +func Float32bits(f float32) uint32 { + return *(*uint32)(unsafe.Pointer(&f)) // ERROR "&f does not escape" +} + +func Float32frombits(b uint32) float32 { + return *(*float32)(unsafe.Pointer(&b)) // ERROR "&b does not escape" +} + +func Float64bits(f float64) uint64 { + return *(*uint64)(unsafe.Pointer(&f)) // ERROR "&f does not escape" +} + +func Float64frombits(b uint64) float64 { + return *(*float64)(unsafe.Pointer(&b)) // ERROR "&b does not escape" +} + +// contrast with +func float64bitsptr(f float64) *uint64 { // ERROR "moved to heap: f" + return (*uint64)(unsafe.Pointer(&f)) // ERROR "&f escapes to heap" +} + +func float64ptrbitsptr(f *float64) *uint64 { // ERROR "leaking param: f" + return (*uint64)(unsafe.Pointer(f)) +} + +func typesw(i interface{}) *int { // ERROR "leaking param: i" + switch val := i.(type) { + case *int: + return val + case *int8: + v := int(*val) // ERROR "moved to heap: v" + return &v // ERROR "&v escapes to heap" + } + return nil +} + +func exprsw(i *int) *int { // ERROR "leaking param: i" + switch j := i; *j + 110 { + case 12: + return j + case 42: + return nil + } + return nil + +} + +// assigning to an array element is like assigning to the array +func foo60(i *int) *int { // ERROR "leaking param: i" + var a [12]*int + a[0] = i + return a[1] +} + +func foo60a(i *int) *int { // ERROR "i does not escape" + var a [12]*int + a[0] = i + return nil +} + +// assigning to a struct field is like assigning to the struct +func foo61(i *int) *int { // ERROR "leaking param: i" + type S struct { + a, b *int + } + var s S + s.a = i + return s.b +} + +func foo61a(i *int) *int { // ERROR "i does not escape" + type S struct { + a, b *int + } + var s S + s.a = i + return nil +} + +// assigning to a struct field is like assigning to the struct but +// here this subtlety is lost, since s.a counts as an assignment to a +// track-losing dereference. +func foo62(i *int) *int { // ERROR "leaking param: i" + type S struct { + a, b *int + } + s := new(S) // ERROR "new[(]S[)] does not escape" + s.a = i + return nil // s.b +} + +type M interface { + M() +} + +func foo63(m M) { // ERROR "m does not escape" +} + +func foo64(m M) { // ERROR "leaking param: m" + m.M() +} + +func foo64b(m M) { // ERROR "leaking param: m" + defer m.M() +} + +type MV int + +func (MV) M() {} + +func foo65() { + var mv MV + foo63(&mv) // ERROR "&mv does not escape" +} + +func foo66() { + var mv MV // ERROR "moved to heap: mv" + foo64(&mv) // ERROR "&mv escapes to heap" +} + +func foo67() { + var mv MV + foo63(mv) +} + +func foo68() { + var mv MV + foo64(mv) // escapes but it's an int so irrelevant +} + +func foo69(m M) { // ERROR "leaking param: m" + foo64(m) +} + +func foo70(mv1 *MV, m M) { // ERROR "leaking param: mv1" "leaking param: m" + m = mv1 + foo64(m) +} + +func foo71(x *int) []*int { // ERROR "leaking param: x" + var y []*int + y = append(y, x) + return y +} + +func foo71a(x int) []*int { // ERROR "moved to heap: x" + var y []*int + y = append(y, &x) // ERROR "&x escapes to heap" + return y +} + +func foo72() { + var x int + var y [1]*int + y[0] = &x // ERROR "&x does not escape" +} + +func foo72aa() [10]*int { + var x int // ERROR "moved to heap: x" + var y [10]*int + y[0] = &x // ERROR "&x escapes to heap" + return y +} + +func foo72a() { + var y [10]*int + for i := 0; i < 10; i++ { + // escapes its scope + x := i // ERROR "moved to heap: x" + y[i] = &x // ERROR "&x escapes to heap" + } + return +} + +func foo72b() [10]*int { + var y [10]*int + for i := 0; i < 10; i++ { + x := i // ERROR "moved to heap: x" + y[i] = &x // ERROR "&x escapes to heap" + } + return y +} + +// issue 2145 +func foo73() { + s := []int{3, 2, 1} // ERROR "\[\]int literal does not escape" + for _, v := range s { + vv := v // ERROR "moved to heap: vv" + // actually just escapes its scope + defer func() { // ERROR "func literal escapes to heap" + println(vv) // ERROR "&vv escapes to heap" + }() + } +} + +func foo74() { + s := []int{3, 2, 1} // ERROR "\[\]int literal does not escape" + for _, v := range s { + vv := v // ERROR "moved to heap: vv" + // actually just escapes its scope + fn := func() { // ERROR "func literal escapes to heap" + println(vv) // ERROR "&vv escapes to heap" + } + defer fn() + } +} + +func myprint(y *int, x ...interface{}) *int { // ERROR "x does not escape" "leaking param: y" + return y +} + +func myprint1(y *int, x ...interface{}) *interface{} { // ERROR "y does not escape" "leaking param: x" + return &x[0] // ERROR "&x.0. escapes to heap" +} + +func foo75(z *int) { // ERROR "leaking param: z" + myprint(z, 1, 2, 3) // ERROR "[.][.][.] argument does not escape" +} + +func foo75a(z *int) { // ERROR "z does not escape" + myprint1(z, 1, 2, 3) // ERROR "[.][.][.] argument escapes to heap" +} + +func foo76(z *int) { // ERROR "leaking param: z" + myprint(nil, z) // ERROR "[.][.][.] argument does not escape" +} + +func foo76a(z *int) { // ERROR "leaking param: z" + myprint1(nil, z) // ERROR "[.][.][.] argument escapes to heap" +} + +func foo76b() { + myprint(nil, 1, 2, 3) // ERROR "[.][.][.] argument does not escape" +} + +func foo76c() { + myprint1(nil, 1, 2, 3) // ERROR "[.][.][.] argument escapes to heap" +} + +func foo76d() { + defer myprint(nil, 1, 2, 3) // ERROR "[.][.][.] argument does not escape" +} + +func foo76e() { + defer myprint1(nil, 1, 2, 3) // ERROR "[.][.][.] argument escapes to heap" +} + +func foo76f() { + for { + // TODO: This one really only escapes its scope, but we don't distinguish yet. + defer myprint(nil, 1, 2, 3) // ERROR "[.][.][.] argument escapes to heap" + } +} + +func foo76g() { + for { + defer myprint1(nil, 1, 2, 3) // ERROR "[.][.][.] argument escapes to heap" + } +} + +func foo77(z []interface{}) { // ERROR "z does not escape" + myprint(nil, z...) // z does not escape +} + +func foo77a(z []interface{}) { // ERROR "leaking param: z" + myprint1(nil, z...) +} + +func foo78(z int) *int { // ERROR "moved to heap: z" + return &z // ERROR "&z escapes to heap" +} + +func foo78a(z int) *int { // ERROR "moved to heap: z" + y := &z // ERROR "&z escapes to heap" + x := &y // ERROR "&y does not escape" + return *x // really return y +} + +func foo79() *int { + return new(int) // ERROR "new[(]int[)] escapes to heap" +} + +func foo80() *int { + var z *int + for { + // Really just escapes its scope but we don't distinguish + z = new(int) // ERROR "new[(]int[)] escapes to heap" + } + _ = z + return nil +} + +func foo81() *int { + for { + z := new(int) // ERROR "new[(]int[)] does not escape" + _ = z + } + return nil +} + +type Fooer interface { + Foo() +} + +type LimitedFooer struct { + Fooer + N int64 +} + +func LimitFooer(r Fooer, n int64) Fooer { // ERROR "leaking param: r" + return &LimitedFooer{r, n} // ERROR "&LimitedFooer literal escapes to heap" +} + +func foo90(x *int) map[*int]*int { // ERROR "leaking param: x" + return map[*int]*int{nil: x} // ERROR "map\[\*int\]\*int literal escapes to heap" +} + +func foo91(x *int) map[*int]*int { // ERROR "leaking param: x" + return map[*int]*int{x: nil} // ERROR "map\[\*int\]\*int literal escapes to heap" +} + +func foo92(x *int) [2]*int { // ERROR "leaking param: x" + return [2]*int{x, nil} +} + +// does not leak c +func foo93(c chan *int) *int { // ERROR "c does not escape" + for v := range c { + return v + } + return nil +} + +// does not leak m +func foo94(m map[*int]*int, b bool) *int { // ERROR "m does not escape" + for k, v := range m { + if b { + return k + } + return v + } + return nil +} + +// does leak x +func foo95(m map[*int]*int, x *int) { // ERROR "m does not escape" "leaking param: x" + m[x] = x +} + +// does not leak m +func foo96(m []*int) *int { // ERROR "m does not escape" + return m[0] +} + +// does leak m +func foo97(m [1]*int) *int { // ERROR "leaking param: m" + return m[0] +} + +// does not leak m +func foo98(m map[int]*int) *int { // ERROR "m does not escape" + return m[0] +} + +// does leak m +func foo99(m *[1]*int) []*int { // ERROR "leaking param: m" + return m[:] +} + +// does not leak m +func foo100(m []*int) *int { // ERROR "m does not escape" + for _, v := range m { + return v + } + return nil +} + +// does leak m +func foo101(m [1]*int) *int { // ERROR "leaking param: m" + for _, v := range m { + return v + } + return nil +} + +// does not leak m +func foo101a(m [1]*int) *int { // ERROR "m does not escape" + for i := range m { // ERROR "moved to heap: i" + return &i // ERROR "&i escapes to heap" + } + return nil +} + +// does leak x +func foo102(m []*int, x *int) { // ERROR "m does not escape" "leaking param: x" + m[0] = x +} + +// does not leak x +func foo103(m [1]*int, x *int) { // ERROR "m does not escape" "x does not escape" + m[0] = x +} + +var y []*int + +// does not leak x +func foo104(x []*int) { // ERROR "x does not escape" + copy(y, x) +} + +// does not leak x +func foo105(x []*int) { // ERROR "x does not escape" + _ = append(y, x...) +} + +// does leak x +func foo106(x *int) { // ERROR "leaking param: x" + _ = append(y, x) +} + +func foo107(x *int) map[*int]*int { // ERROR "leaking param: x" + return map[*int]*int{x: nil} // ERROR "map.* literal escapes to heap" +} + +func foo108(x *int) map[*int]*int { // ERROR "leaking param: x" + return map[*int]*int{nil: x} // ERROR "map.* literal escapes to heap" +} + +func foo109(x *int) *int { // ERROR "leaking param: x" + m := map[*int]*int{x: nil} // ERROR "map.* literal does not escape" + for k, _ := range m { + return k + } + return nil +} + +func foo110(x *int) *int { // ERROR "leaking param: x" + m := map[*int]*int{nil: x} // ERROR "map.* literal does not escape" + return m[nil] +} + +func foo111(x *int) *int { // ERROR "leaking param: x" + m := []*int{x} // ERROR "\[\]\*int literal does not escape" + return m[0] +} + +func foo112(x *int) *int { // ERROR "leaking param: x" + m := [1]*int{x} + return m[0] +} + +func foo113(x *int) *int { // ERROR "leaking param: x" + m := Bar{ii: x} + return m.ii +} + +func foo114(x *int) *int { // ERROR "leaking param: x" + m := &Bar{ii: x} // ERROR "&Bar literal does not escape" + return m.ii +} + +func foo115(x *int) *int { // ERROR "leaking param: x" + return (*int)(unsafe.Pointer(uintptr(unsafe.Pointer(x)) + 1)) +} + +func foo116(b bool) *int { + if b { + x := 1 // ERROR "moved to heap: x" + return &x // ERROR "&x escapes to heap" + } else { + y := 1 // ERROR "moved to heap: y" + return &y // ERROR "&y escapes to heap" + } + return nil +} + +func foo117(unknown func(interface{})) { // ERROR "unknown does not escape" + x := 1 // ERROR "moved to heap: x" + unknown(&x) // ERROR "&x escapes to heap" +} + +func foo118(unknown func(*int)) { // ERROR "unknown does not escape" + x := 1 // ERROR "moved to heap: x" + unknown(&x) // ERROR "&x escapes to heap" +} + +func external(*int) + +func foo119(x *int) { // ERROR "leaking param: x" + external(x) +} + +func foo120() { + // formerly exponential time analysis +L1: +L2: +L3: +L4: +L5: +L6: +L7: +L8: +L9: +L10: +L11: +L12: +L13: +L14: +L15: +L16: +L17: +L18: +L19: +L20: +L21: +L22: +L23: +L24: +L25: +L26: +L27: +L28: +L29: +L30: +L31: +L32: +L33: +L34: +L35: +L36: +L37: +L38: +L39: +L40: +L41: +L42: +L43: +L44: +L45: +L46: +L47: +L48: +L49: +L50: +L51: +L52: +L53: +L54: +L55: +L56: +L57: +L58: +L59: +L60: +L61: +L62: +L63: +L64: +L65: +L66: +L67: +L68: +L69: +L70: +L71: +L72: +L73: +L74: +L75: +L76: +L77: +L78: +L79: +L80: +L81: +L82: +L83: +L84: +L85: +L86: +L87: +L88: +L89: +L90: +L91: +L92: +L93: +L94: +L95: +L96: +L97: +L98: +L99: +L100: + // use the labels to silence compiler errors + goto L1 + goto L2 + goto L3 + goto L4 + goto L5 + goto L6 + goto L7 + goto L8 + goto L9 + goto L10 + goto L11 + goto L12 + goto L13 + goto L14 + goto L15 + goto L16 + goto L17 + goto L18 + goto L19 + goto L20 + goto L21 + goto L22 + goto L23 + goto L24 + goto L25 + goto L26 + goto L27 + goto L28 + goto L29 + goto L30 + goto L31 + goto L32 + goto L33 + goto L34 + goto L35 + goto L36 + goto L37 + goto L38 + goto L39 + goto L40 + goto L41 + goto L42 + goto L43 + goto L44 + goto L45 + goto L46 + goto L47 + goto L48 + goto L49 + goto L50 + goto L51 + goto L52 + goto L53 + goto L54 + goto L55 + goto L56 + goto L57 + goto L58 + goto L59 + goto L60 + goto L61 + goto L62 + goto L63 + goto L64 + goto L65 + goto L66 + goto L67 + goto L68 + goto L69 + goto L70 + goto L71 + goto L72 + goto L73 + goto L74 + goto L75 + goto L76 + goto L77 + goto L78 + goto L79 + goto L80 + goto L81 + goto L82 + goto L83 + goto L84 + goto L85 + goto L86 + goto L87 + goto L88 + goto L89 + goto L90 + goto L91 + goto L92 + goto L93 + goto L94 + goto L95 + goto L96 + goto L97 + goto L98 + goto L99 + goto L100 +} + +func foo121() { + for i := 0; i < 10; i++ { + defer myprint(nil, i) // ERROR "[.][.][.] argument escapes to heap" + go myprint(nil, i) // ERROR "[.][.][.] argument escapes to heap" + } +} + +// same as foo121 but check across import +func foo121b() { + for i := 0; i < 10; i++ { + defer fmt.Printf("%d", i) // ERROR "[.][.][.] argument escapes to heap" + go fmt.Printf("%d", i) // ERROR "[.][.][.] argument escapes to heap" + } +} + +// a harmless forward jump +func foo122() { + var i *int + + goto L1 +L1: + i = new(int) // ERROR "does not escape" + _ = i +} + +// a backward jump, increases loopdepth +func foo123() { + var i *int + +L1: + i = new(int) // ERROR "escapes" + + goto L1 + _ = i +} diff --git a/gcc/testsuite/go.test/test/escape3.go b/gcc/testsuite/go.test/test/escape3.go new file mode 100644 index 00000000000..fc2d6ebbe4b --- /dev/null +++ b/gcc/testsuite/go.test/test/escape3.go @@ -0,0 +1,36 @@ +// $G $D/$F.go && $L $F.$A && ./$A.out + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Test run-time behavior of escape analysis-related optimizations. + +package main + +func main() { + test1() +} + +func test1() { + check1(0) + check1(1) + check1(2) +} + +type T1 struct { + X, Y, Z int +} + +func f() int { + return 1 +} + +func check1(pass int) T1 { + v := []T1{{X: f(), Z: f()}} + if v[0].Y != 0 { + panic("nonzero init") + } + v[0].Y = pass + return v[0] +} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug027.go b/gcc/testsuite/go.test/test/fixedbugs/bug027.go index acc295d51aa..cf2daaecf06 100644 --- a/gcc/testsuite/go.test/test/fixedbugs/bug027.go +++ b/gcc/testsuite/go.test/test/fixedbugs/bug027.go @@ -6,53 +6,76 @@ package main +import "fmt" + type Element interface { } type Vector struct { - nelem int; - elem []Element; + nelem int + elem []Element } func New() *Vector { - v := new(Vector); - v.nelem = 0; - v.elem = make([]Element, 10); - return v; + v := new(Vector) + v.nelem = 0 + v.elem = make([]Element, 10) + return v } func (v *Vector) At(i int) Element { - return v.elem[i]; + return v.elem[i] } func (v *Vector) Insert(e Element) { - v.elem[v.nelem] = e; - v.nelem++; + v.elem[v.nelem] = e + v.nelem++ } func main() { - type I struct { val int; }; - i0 := new(I); i0.val = 0; - i1 := new(I); i1.val = 11; - i2 := new(I); i2.val = 222; - i3 := new(I); i3.val = 3333; - i4 := new(I); i4.val = 44444; - v := New(); - print("hi\n"); - v.Insert(i4); - v.Insert(i3); - v.Insert(i2); - v.Insert(i1); - v.Insert(i0); + type I struct{ val int } + i0 := new(I) + i0.val = 0 + i1 := new(I) + i1.val = 11 + i2 := new(I) + i2.val = 222 + i3 := new(I) + i3.val = 3333 + i4 := new(I) + i4.val = 44444 + v := New() + r := "hi\n" + v.Insert(i4) + v.Insert(i3) + v.Insert(i2) + v.Insert(i1) + v.Insert(i0) for i := 0; i < v.nelem; i++ { - var x *I; - x = v.At(i).(*I); - print(i, " ", x.val, "\n"); // prints correct list + var x *I + x = v.At(i).(*I) + r += fmt.Sprintln(i, x.val) // prints correct list } for i := 0; i < v.nelem; i++ { - print(i, " ", v.At(i).(*I).val, "\n"); + r += fmt.Sprintln(i, v.At(i).(*I).val) + } + expect := `hi +0 44444 +1 3333 +2 222 +3 11 +4 0 +0 44444 +1 3333 +2 222 +3 11 +4 0 +` + if r != expect { + panic(r) } } + /* bug027.go:50: illegal types for operand (<Element>I{}) CONV (<I>{}) diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug067.go b/gcc/testsuite/go.test/test/fixedbugs/bug067.go index b812f01169c..328d191bb42 100644 --- a/gcc/testsuite/go.test/test/fixedbugs/bug067.go +++ b/gcc/testsuite/go.test/test/fixedbugs/bug067.go @@ -10,6 +10,6 @@ var c chan int func main() { c = make(chan int); - go func() { print("ok\n"); c <- 0 } (); + go func() { c <- 0 } (); <-c } diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug070.go b/gcc/testsuite/go.test/test/fixedbugs/bug070.go index 6afdd467d99..24ac7798889 100644 --- a/gcc/testsuite/go.test/test/fixedbugs/bug070.go +++ b/gcc/testsuite/go.test/test/fixedbugs/bug070.go @@ -6,20 +6,35 @@ package main +import "fmt" + func main() { - var i, k int; - outer: - for k=0; k<2; k++ { - print("outer loop top k ", k, "\n"); - if k != 0 { panic("k not zero") } // inner loop breaks this one every time - for i=0; i<2; i++ { - if i != 0 { panic("i not zero") } // loop breaks every time - print("inner loop top i ", i, "\n"); + var i, k int + var r string +outer: + for k = 0; k < 2; k++ { + r += fmt.Sprintln("outer loop top k", k) + if k != 0 { + panic("k not zero") + } // inner loop breaks this one every time + for i = 0; i < 2; i++ { + if i != 0 { + panic("i not zero") + } // loop breaks every time + r += fmt.Sprintln("inner loop top i", i) if true { - print("do break\n"); - break outer; + r += "do break\n" + break outer } } } - print("broke\n"); + r += "broke\n" + expect := `outer loop top k 0 +inner loop top i 0 +do break +broke +` + if r != expect { + panic(r) + } } diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug093.go b/gcc/testsuite/go.test/test/fixedbugs/bug093.go index f80eee01fa7..52d92c7e3d4 100644 --- a/gcc/testsuite/go.test/test/fixedbugs/bug093.go +++ b/gcc/testsuite/go.test/test/fixedbugs/bug093.go @@ -10,7 +10,6 @@ type S struct { } func (p *S) M() { - print("M\n"); } type I interface { diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug113.go b/gcc/testsuite/go.test/test/fixedbugs/bug113.go index 4fd322d5311..4ca07dc65a7 100644 --- a/gcc/testsuite/go.test/test/fixedbugs/bug113.go +++ b/gcc/testsuite/go.test/test/fixedbugs/bug113.go @@ -1,4 +1,4 @@ -// $G $D/$F.go && $L $F.$A && (! ./$A.out || echo BUG: should not succeed) +// $G $D/$F.go && $L $F.$A && ./$A.out // Copyright 2009 The Go Authors. All rights reserved. // Use of this source code is governed by a BSD-style @@ -21,8 +21,24 @@ func main() { if foo2(v2) != 1 { panic(2) } + + shouldPanic(p1) +} + +func p1() { + var i I + i = 1 var v3 = i.(int32) // This type conversion should fail at runtime. if foo2(v3) != 1 { panic(3) } } + +func shouldPanic(f func()) { + defer func() { + if recover() == nil { + panic("function should panic") + } + }() + f() +} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug148.go b/gcc/testsuite/go.test/test/fixedbugs/bug148.go index daedff10537..251020c96f7 100644 --- a/gcc/testsuite/go.test/test/fixedbugs/bug148.go +++ b/gcc/testsuite/go.test/test/fixedbugs/bug148.go @@ -1,4 +1,4 @@ -// $G $D/$F.go && $L $F.$A && ! ./$A.out || echo BUG: should crash +// $G $D/$F.go && $L $F.$A && ./$A.out // Copyright 2009 The Go Authors. All rights reserved. // Use of this source code is governed by a BSD-style @@ -8,6 +8,8 @@ package main type T struct {a, b int}; +func println(x, y int) { } + func f(x interface{}) interface{} { type T struct {a, b int}; @@ -24,16 +26,29 @@ func main() { inner_T := f(nil); f(inner_T); + shouldPanic(p1) +} + +func p1() { outer_T := T{5, 7}; f(outer_T); } +func shouldPanic(f func()) { + defer func() { + if recover() == nil { + panic("function should panic") + } + }() + f() +} + /* This prints: 2 3 5 7 -but it should crash: The type assertion on line 14 should fail +but it should crash: The type assertion on line 18 should fail for the 2nd call to f with outer_T. */ diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug220.go b/gcc/testsuite/go.test/test/fixedbugs/bug220.go deleted file mode 100644 index ff027ddc229..00000000000 --- a/gcc/testsuite/go.test/test/fixedbugs/bug220.go +++ /dev/null @@ -1,14 +0,0 @@ -// $G $D/$F.go || echo BUG: bug220 - -// Copyright 2009 The Go Authors. All rights reserved. -// Use of this source code is governed by a BSD-style -// license that can be found in the LICENSE file. - -package main - -func main() { - m := make(map[int]map[uint]float64) - - m[0] = make(map[uint]float64), false // 6g used to reject this - m[1] = nil -} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug242.go b/gcc/testsuite/go.test/test/fixedbugs/bug242.go index 839dccd3741..d80ae76a215 100644 --- a/gcc/testsuite/go.test/test/fixedbugs/bug242.go +++ b/gcc/testsuite/go.test/test/fixedbugs/bug242.go @@ -93,7 +93,8 @@ func main() { m[13] = 'B' // 13 14 - m[gint()] = gbyte(), false + delete(m, gint()) + gbyte() if _, present := m[13]; present { println("bad map removal") panic("fail") diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug270.go b/gcc/testsuite/go.test/test/fixedbugs/bug270.go deleted file mode 100644 index a9cda7bd7cb..00000000000 --- a/gcc/testsuite/go.test/test/fixedbugs/bug270.go +++ /dev/null @@ -1,21 +0,0 @@ -// $G $D/$F.go - -// Copyright 2010 The Go Authors. All rights reserved. -// Use of this source code is governed by a BSD-style -// license that can be found in the LICENSE file. - -// http://code.google.com/p/go/issues/detail?id=746 - -package main - -type I interface { F() } - -type T struct{} - -func (T) F() {} - -func main() { - switch I(T{}).(type) { - case interface{}: - } -} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug286.go b/gcc/testsuite/go.test/test/fixedbugs/bug286.go index 94423be8171..eb678385610 100644 --- a/gcc/testsuite/go.test/test/fixedbugs/bug286.go +++ b/gcc/testsuite/go.test/test/fixedbugs/bug286.go @@ -12,16 +12,14 @@ type I interface { f() } - var callee string -var error bool +var error_ bool type T int func (t *T) f() { callee = "f" } func (i *T) g() { callee = "g" } - // test1 and test2 are the same except that in the interface J // the entries are swapped. test2 and test3 are the same except // that in test3 the interface J is declared outside the function. @@ -36,11 +34,10 @@ func test1(x I) { x.(J).f() if callee != "f" { println("test1 called", callee) - error = true + error_ = true } } - func test2(x I) { type J interface { g() @@ -49,11 +46,10 @@ func test2(x I) { x.(J).f() if callee != "f" { println("test2 called", callee) - error = true + error_ = true } } - type J interface { g() I @@ -63,7 +59,7 @@ func test3(x I) { x.(J).f() if callee != "f" { println("test3 called", callee) - error = true + error_ = true } } @@ -72,7 +68,7 @@ func main() { test1(x) test2(x) test3(x) - if error { + if error_ { panic("wrong method called") } } diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug328.go b/gcc/testsuite/go.test/test/fixedbugs/bug328.go index 64041f41290..825298371f9 100644 --- a/gcc/testsuite/go.test/test/fixedbugs/bug328.go +++ b/gcc/testsuite/go.test/test/fixedbugs/bug328.go @@ -1,4 +1,4 @@ -// $G $D/$F.go && $L $F.$A && ./$A.out +// $G $D/$F.go && $L $F.$A && ./$A.out 2>&1 | cmp - $D/$F.out // Copyright 2011 The Go Authors. All rights reserved. // Use of this source code is governed by a BSD-style diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug328.out b/gcc/testsuite/go.test/test/fixedbugs/bug328.out new file mode 100644 index 00000000000..9982566dc09 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug328.out @@ -0,0 +1 @@ +0x0 diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug340.go b/gcc/testsuite/go.test/test/fixedbugs/bug340.go index af72513e328..34cc013151f 100644 --- a/gcc/testsuite/go.test/test/fixedbugs/bug340.go +++ b/gcc/testsuite/go.test/test/fixedbugs/bug340.go @@ -10,8 +10,8 @@ package main func main() { var x interface{} - switch t := x.(type) { // GC_ERROR "0 is not a type" - case 0: // GCCGO_ERROR "expected type" - t.x = 1 // ERROR "type interface \{ \}|reference to undefined field or method" + switch t := x.(type) { + case 0: // ERROR "type" + t.x = 1 // ERROR "type interface \{\}|reference to undefined field or method" } } diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug365.go b/gcc/testsuite/go.test/test/fixedbugs/bug365.go index ce695050440..bc8c2c5e62c 100644 --- a/gcc/testsuite/go.test/test/fixedbugs/bug365.go +++ b/gcc/testsuite/go.test/test/fixedbugs/bug365.go @@ -12,11 +12,11 @@ package main type S struct { - err os.Error // ERROR "undefined|expected package" + err foo.Bar // ERROR "undefined|expected package" Num int } func main() { s := S{} - _ = s.Num // no error here please + _ = s.Num // no error here please } diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug366.go b/gcc/testsuite/go.test/test/fixedbugs/bug366.go new file mode 100644 index 00000000000..8c000f50a93 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug366.go @@ -0,0 +1,37 @@ +// $G $D/$F.go && $L $F.$A && ./$A.out + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Issue 2206. Incorrect sign extension of div arguments. + +package main + +func five(x int64) { + if x != 5 { + panic(x) + } +} + +func main() { + // 5 + five(int64(5 / (5 / 3))) + + // 5 + five(int64(byte(5) / (byte(5) / byte(3)))) + + // 5 + var a, b byte = 5, 3 + five(int64(a / (a / b))) + + // integer divide by zero in golang.org sandbox + // 0 on windows/amd64 + x := [3]byte{2, 3, 5} + five(int64(x[2] / (x[2] / x[1]))) + + // integer divide by zero in golang.org sandbox + // crash on windows/amd64 + y := x[1:3] + five(int64(y[1] / (y[1] / y[0]))) +}
\ No newline at end of file diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug367.dir/main.go b/gcc/testsuite/go.test/test/fixedbugs/bug367.dir/main.go new file mode 100644 index 00000000000..21e9a5002c9 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug367.dir/main.go @@ -0,0 +1,24 @@ +package main + +import ( + "./p" +) + +type T struct{ *p.S } +type I interface { + get() +} + +func main() { + var t T + p.F(t) + var x interface{} = t + _, ok := x.(I) + if ok { + panic("should not satisfy main.I") + } + _, ok = x.(p.I) + if !ok { + panic("should satisfy p.I") + } +} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug367.dir/p.go b/gcc/testsuite/go.test/test/fixedbugs/bug367.dir/p.go new file mode 100644 index 00000000000..c8772d2d051 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug367.dir/p.go @@ -0,0 +1,15 @@ +package p + +type T struct{ x int } +type S struct{} + +func (p *S) get() { +} + +type I interface { + get() +} + +func F(i I) { + i.get() +} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug367.go b/gcc/testsuite/go.test/test/fixedbugs/bug367.go new file mode 100644 index 00000000000..25d11a15318 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug367.go @@ -0,0 +1,7 @@ +// $G $D/$F.dir/p.go && $G $D/$F.dir/main.go && $L main.$A && ./$A.out || echo BUG: should not fail + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package ignored diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug368.go b/gcc/testsuite/go.test/test/fixedbugs/bug368.go new file mode 100644 index 00000000000..8d94f531c9b --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug368.go @@ -0,0 +1,26 @@ +// $G $D/$F.go && $L $F.$A && ./$A.out + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package main + +// 5g bug used to set up the 0 for -f() before calling f, +// and the call to f smashed the register. + +func f(n int) int { + s := 0 + for i := 0; i < n; i++ { + s += i>>1 + } + return s +} + +func main() { + x := -f(100) + if x != -2450 { + println(x) + panic("broken") + } +} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug369.dir/pkg.go b/gcc/testsuite/go.test/test/fixedbugs/bug369.dir/pkg.go new file mode 100644 index 00000000000..cf57041928a --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug369.dir/pkg.go @@ -0,0 +1,15 @@ +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package pkg + +func NonASCII(b []byte, i int) int { + for i = 0; i < len(b); i++ { + if b[i] >= 0x80 { + break + } + } + return i +} + diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug369.go b/gcc/testsuite/go.test/test/fixedbugs/bug369.go new file mode 100644 index 00000000000..8eb23eecf16 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug369.go @@ -0,0 +1,59 @@ +// $G -N -o slow.$A $D/bug369.dir/pkg.go && +// $G -o fast.$A $D/bug369.dir/pkg.go && +// $G $D/$F.go && $L $F.$A && ./$A.out + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Test that compiling with optimization turned on produces faster code. + +package main + +import ( + "flag" + "os" + "runtime" + "testing" + + fast "./fast" + slow "./slow" +) + +var buf = make([]byte, 1048576) + +func BenchmarkFastNonASCII(b *testing.B) { + for i := 0; i < b.N; i++ { + fast.NonASCII(buf, 0) + } +} + +func BenchmarkSlowNonASCII(b *testing.B) { + for i := 0; i < b.N; i++ { + slow.NonASCII(buf, 0) + } +} + +func main() { + os.Args = []string{os.Args[0], "-test.benchtime=0.1"} + flag.Parse() + + rslow := testing.Benchmark(BenchmarkSlowNonASCII) + rfast := testing.Benchmark(BenchmarkFastNonASCII) + tslow := rslow.NsPerOp() + tfast := rfast.NsPerOp() + + // Optimization should be good for at least 2x, but be forgiving. + // On the ARM simulator we see closer to 1.5x. + speedup := float64(tslow)/float64(tfast) + want := 1.8 + if runtime.GOARCH == "arm" { + want = 1.3 + } + if speedup < want { + // TODO(rsc): doesn't work on linux-amd64 or darwin-amd64 builders, nor on + // a Lenovo x200 (linux-amd64) laptop. + //println("fast:", tfast, "slow:", tslow, "speedup:", speedup, "want:", want) + //println("not fast enough") + } +} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug370.go b/gcc/testsuite/go.test/test/fixedbugs/bug370.go new file mode 100644 index 00000000000..9cb45f6e0de --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug370.go @@ -0,0 +1,18 @@ +// $G $D/$F.go && $L $F.$A && ./$A.out + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package main + +// issue 2337 +// The program deadlocked. + +import "runtime" + +func main() { + runtime.GOMAXPROCS(2) + runtime.GC() + runtime.GOMAXPROCS(1) +} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug371.go b/gcc/testsuite/go.test/test/fixedbugs/bug371.go new file mode 100644 index 00000000000..bf993df0680 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug371.go @@ -0,0 +1,24 @@ +// errchk $G $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// issue 2343 + +package main + +type T struct {} + +func (t *T) pm() {} +func (t T) m() {} + +func main() { + p := &T{} + p.pm() + p.m() + + q := &p + q.m() // ERROR "requires explicit dereference" + q.pm() +} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug372.go b/gcc/testsuite/go.test/test/fixedbugs/bug372.go new file mode 100644 index 00000000000..a6f7208bbd5 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug372.go @@ -0,0 +1,28 @@ +// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug372 + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Issue 2355 +package main + +type T struct {} +func (T) m() string { return "T" } + +type TT struct { + T + m func() string +} + + +func ff() string { return "ff" } + +func main() { + var tt TT + tt.m = ff + + if tt.m() != "ff" { + println(tt.m(), "!= \"ff\"") + } +} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug373.go b/gcc/testsuite/go.test/test/fixedbugs/bug373.go new file mode 100644 index 00000000000..934a6c7328c --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug373.go @@ -0,0 +1,32 @@ +// errchk $G $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Issue 873, 2162 + +package foo + +func f(x interface{}) { + switch t := x.(type) { // ERROR "declared and not used" + case int: + } +} + +func g(x interface{}) { + switch t := x.(type) { + case int: + case float32: + println(t) + } +} + +func h(x interface{}) { + switch t := x.(type) { + case int: + case float32: + default: + println(t) + } +} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug374.go b/gcc/testsuite/go.test/test/fixedbugs/bug374.go new file mode 100644 index 00000000000..b55c5df4567 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug374.go @@ -0,0 +1,20 @@ +// errchk $G $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// issue 1556 +package foo + +type I interface { + m() int +} + +type T int + +var _ I = T(0) // GCCGO_ERROR "incompatible" + +func (T) m(buf []byte) (a int, b xxxx) { // ERROR "xxxx" + return 0, nil +} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug375.go b/gcc/testsuite/go.test/test/fixedbugs/bug375.go new file mode 100644 index 00000000000..52735852637 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug375.go @@ -0,0 +1,19 @@ +// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug375 + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Issue 2423 + +package main + +func main() { + var x interface{} = "hello" + + switch x { + case "hello": + default: + println("FAIL") + } +} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug376.go b/gcc/testsuite/go.test/test/fixedbugs/bug376.go new file mode 100644 index 00000000000..1efbeecf21c --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug376.go @@ -0,0 +1,11 @@ +// errchk $G $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// issue 1951 +package foo +import "unsafe" +var v = unsafe.Sizeof // ERROR "must be called" + diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug377.dir/one.go b/gcc/testsuite/go.test/test/fixedbugs/bug377.dir/one.go new file mode 100644 index 00000000000..c9060756b1a --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug377.dir/one.go @@ -0,0 +1,6 @@ +package one + +func Foo() (n int64, _ *int) { + return 42, nil +} + diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug377.dir/two.go b/gcc/testsuite/go.test/test/fixedbugs/bug377.dir/two.go new file mode 100644 index 00000000000..8a5346ab72b --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug377.dir/two.go @@ -0,0 +1,4 @@ +package two + +import _ "./one" + diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug377.go b/gcc/testsuite/go.test/test/fixedbugs/bug377.go new file mode 100644 index 00000000000..e905e34d683 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug377.go @@ -0,0 +1,9 @@ +// $G $D/$F.dir/one.go && $G $D/$F.dir/two.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Issue 1802 + +package ignored diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug378.go b/gcc/testsuite/go.test/test/fixedbugs/bug378.go new file mode 100644 index 00000000000..b393b3dc1e9 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug378.go @@ -0,0 +1,19 @@ +// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug378 + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Issue 2497 + +package main + +type Header struct{} +func (h Header) Method() {} + +var _ interface{} = Header{} + +func main() { + type X Header + var _ interface{} = X{} +} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug379.go b/gcc/testsuite/go.test/test/fixedbugs/bug379.go new file mode 100644 index 00000000000..3dd3d2983bd --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug379.go @@ -0,0 +1,18 @@ +// errchk $G $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Issue 2452. + +// Check that the error messages says +// bug378.go:17: 1 + 2 not used +// and not +// bug378.go:17: 1 not used + +package main + +func main() { + 1 + 2 // ERROR "1 \+ 2 not used|value computed is not used" +} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug380.go b/gcc/testsuite/go.test/test/fixedbugs/bug380.go new file mode 100644 index 00000000000..75b58064f5d --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug380.go @@ -0,0 +1,11 @@ +// $G $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Used to cause a typechecking loop error. + +package pkg +type T map[int]string +var q = &T{} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug381.go b/gcc/testsuite/go.test/test/fixedbugs/bug381.go new file mode 100644 index 00000000000..3f3232bf12f --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug381.go @@ -0,0 +1,20 @@ +// errchk $G $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Issue 2276. + +// Check that the error messages says +// bug378.go:19: unsafe.Alignof(0) not used +// and not +// bug378.go:19: 4 not used + +package main + +import "unsafe" + +func main() { + unsafe.Alignof(0) // ERROR "unsafe\.Alignof|value computed is not used" +} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug382.dir/pkg.go b/gcc/testsuite/go.test/test/fixedbugs/bug382.dir/pkg.go new file mode 100644 index 00000000000..f8d75d45419 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug382.dir/pkg.go @@ -0,0 +1,7 @@ +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package pkg +type T struct {} +var E T diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug382.go b/gcc/testsuite/go.test/test/fixedbugs/bug382.go new file mode 100644 index 00000000000..6212fbf507c --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug382.go @@ -0,0 +1,10 @@ +// $G $D/$F.dir/pkg.go && $G $D/$F.go || echo "Bug 382" + +// Issue 2529 + +package main +import "./pkg" + +var x = pkg.E + +var fo = struct {F pkg.T}{F: x} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug383.go b/gcc/testsuite/go.test/test/fixedbugs/bug383.go new file mode 100644 index 00000000000..181a897b63d --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug383.go @@ -0,0 +1,13 @@ +// errchk $G $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Issue 2520 + +package main +func main() { + if 2e9 { } // ERROR "2e.09|expected bool" + if 3.14+1i { } // ERROR "3.14 . 1i|expected bool" +} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug384.go b/gcc/testsuite/go.test/test/fixedbugs/bug384.go new file mode 100644 index 00000000000..b3d64668829 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug384.go @@ -0,0 +1,12 @@ +// errchk $G $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Issue 2500 + +package foo + +// Check that we only get root cause message, no further complaints about r undefined +func (r *indexWriter) foo() {} // ERROR "undefined.*indexWriter" diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug385_32.go b/gcc/testsuite/go.test/test/fixedbugs/bug385_32.go new file mode 100644 index 00000000000..a009f664e09 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug385_32.go @@ -0,0 +1,14 @@ +// [ $O == 6 ] || errchk $G -e $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Issue 2444 + +package main +func main() { + var arr [1000200030]int // ERROR "type .* too large" + arr_bkup := arr + _ = arr_bkup +}
\ No newline at end of file diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug385_64.go b/gcc/testsuite/go.test/test/fixedbugs/bug385_64.go new file mode 100644 index 00000000000..701be0d09ac --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug385_64.go @@ -0,0 +1,15 @@ +// [ $O != 6 ] || errchk $G -e $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Issue 2444 + +package main +func main() { // ERROR "stack frame too large" + var arr [1000200030]int + arr_bkup := arr + _ = arr_bkup +} + diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug386.go b/gcc/testsuite/go.test/test/fixedbugs/bug386.go new file mode 100644 index 00000000000..b42c07073b0 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug386.go @@ -0,0 +1,12 @@ +// errchk $G $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Issue 2451, 2452 +package foo + +func f() error { return 0 } // ERROR "cannot use 0 .type int.|has no methods" + +func g() error { return -1 } // ERROR "cannot use -1 .type int.|has no methods" diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug387.go b/gcc/testsuite/go.test/test/fixedbugs/bug387.go new file mode 100644 index 00000000000..c9db4aea89f --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug387.go @@ -0,0 +1,30 @@ +// $G $D/$F.go || echo "Bug387" + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Issue 2549 + +/* Used to die with +missing typecheck: [7f5bf07b4438] + +. AS l(45) +. . NAME-main.autotmp_0017 u(1) a(1) l(45) x(0+0) class(PAUTO) +esc(N) tc(1) used(1) ARRAY-[2]string +internal compiler error: missing typecheck +*/ +package main + +import ( + "fmt" + "path/filepath" +) + +func main() { + switch _, err := filepath.Glob(filepath.Join(".", "vnc")); { + case err != nil: + fmt.Println(err) + } +} + diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug388.go b/gcc/testsuite/go.test/test/fixedbugs/bug388.go new file mode 100644 index 00000000000..1459285b2fa --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug388.go @@ -0,0 +1,39 @@ +// errchk $G $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Issue 2231 + +package main +import "runtime" + +func foo(runtime.UintType, i int) { // ERROR "cannot declare name runtime.UintType|named/anonymous mix" + println(i, runtime.UintType) +} + +func bar(i int) { + runtime.UintType := i // ERROR "cannot declare name runtime.UintType|non-name on left side" + println(runtime.UintType) // GCCGO_ERROR "invalid use of type" +} + +func baz() { + main.i := 1 // ERROR "non-name main.i|non-name on left side" + println(main.i) // GCCGO_ERROR "no fields or methods" +} + +func qux() { + var main.i // ERROR "unexpected [.]|expected type" + println(main.i) +} + +func corge() { + var foo.i int // ERROR "unexpected [.]|expected type" + println(foo.i) +} + +func main() { + foo(42,43) + bar(1969) +} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug389.go b/gcc/testsuite/go.test/test/fixedbugs/bug389.go new file mode 100644 index 00000000000..ecbbbdd585e --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug389.go @@ -0,0 +1,12 @@ +// errchk $G $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Issue 2563 +package foo + +func fn(a float32) {} + +var f func(arg int) = fn // ERROR "cannot use fn .type func.float32.. as type func.int. in assignment|different parameter types" diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug390.go b/gcc/testsuite/go.test/test/fixedbugs/bug390.go new file mode 100644 index 00000000000..31c4dd40bab --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug390.go @@ -0,0 +1,16 @@ +// errchk $G -e $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Issue 2627 -- unsafe.Pointer type isn't handled nicely in some errors + +package main + +import "unsafe" + +func main() { + var x *int + _ = unsafe.Pointer(x) - unsafe.Pointer(x) // ERROR "operator - not defined on unsafe.Pointer|expected integer, floating, or complex type" +} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug391.go b/gcc/testsuite/go.test/test/fixedbugs/bug391.go new file mode 100644 index 00000000000..81507188b23 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug391.go @@ -0,0 +1,14 @@ +// $G $D/$F.go || echo "Issue2576" + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Issue 2576 +package bug + +type T struct { a int } + +func f(t T) { + switch _, _ = t.a, t.a; {} +}
\ No newline at end of file diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug392.dir/one.go b/gcc/testsuite/go.test/test/fixedbugs/bug392.dir/one.go new file mode 100644 index 00000000000..a7017255e5a --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug392.dir/one.go @@ -0,0 +1,22 @@ +// Copyright 2012 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Functions that the inliner exported incorrectly. + +package one + +type T int + +// Issue 2678 +func F1(T *T) bool { return T == nil } + +// Issue 2682. +func F2(c chan int) bool { return c == (<-chan int)(nil) } + +// Use of single named return value. +func F3() (ret []int) { return append(ret, 1) } + +// Call of inlined method with blank receiver. +func (_ *T) M() int { return 1 } +func (t *T) MM() int { return t.M() } diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug392.dir/two.go b/gcc/testsuite/go.test/test/fixedbugs/bug392.dir/two.go new file mode 100644 index 00000000000..b0ce26d39ab --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug392.dir/two.go @@ -0,0 +1,20 @@ +// Copyright 2012 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Use the functions in one.go so that the inlined +// forms get type-checked. + +package two + +import "./one" + +func use() { + one.F1(nil) + one.F2(nil) + one.F3() + + var t *one.T + t.M() + t.MM() +} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug392.go b/gcc/testsuite/go.test/test/fixedbugs/bug392.go new file mode 100644 index 00000000000..50af6006fbe --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug392.go @@ -0,0 +1,7 @@ +// $G $D/$F.dir/one.go && $G $D/$F.dir/two.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package ignored diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug393.go b/gcc/testsuite/go.test/test/fixedbugs/bug393.go new file mode 100644 index 00000000000..e21b9c4a416 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug393.go @@ -0,0 +1,30 @@ +// $G $D/$F.go || echo BUG: bug393 + +// Copyright 2012 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// issue 2672 +// was trying binary search with an interface type + +package main + +func f(x interface{}) int { + switch x { + case 1: + return 1 + case 2: + return 2 + case 3: + return 3 + case 4: + return 4 + case "5": + return 5 + case "6": + return 6 + default: + return 7 + } + panic("switch") +} diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug394.go b/gcc/testsuite/go.test/test/fixedbugs/bug394.go new file mode 100644 index 00000000000..42c20e7a918 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug394.go @@ -0,0 +1,10 @@ +// errchk $G $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Issue 2598 +package foo + +return nil // ERROR "non-declaration statement outside function body|expected declaration" diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug396.dir/one.go b/gcc/testsuite/go.test/test/fixedbugs/bug396.dir/one.go new file mode 100644 index 00000000000..7902a07d535 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug396.dir/one.go @@ -0,0 +1,9 @@ +// Copyright 2012 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package one + +type T struct { int } + +func New(i int) T { return T{i} } diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug396.dir/two.go b/gcc/testsuite/go.test/test/fixedbugs/bug396.dir/two.go new file mode 100644 index 00000000000..9b32508fd4f --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug396.dir/two.go @@ -0,0 +1,14 @@ +// Copyright 2012 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Use the functions in one.go so that the inlined +// forms get type-checked. + +package two + +import "./one" + +func use() { + _ = one.New(1) +}
\ No newline at end of file diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug396.go b/gcc/testsuite/go.test/test/fixedbugs/bug396.go new file mode 100644 index 00000000000..50af6006fbe --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug396.go @@ -0,0 +1,7 @@ +// $G $D/$F.dir/one.go && $G $D/$F.dir/two.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package ignored diff --git a/gcc/testsuite/go.test/test/fixedbugs/bug397.go b/gcc/testsuite/go.test/test/fixedbugs/bug397.go new file mode 100644 index 00000000000..03957013023 --- /dev/null +++ b/gcc/testsuite/go.test/test/fixedbugs/bug397.go @@ -0,0 +1,13 @@ +// errchk $G -e $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package main + +// Issue 2623 +var m = map[string]int { + "abc":1, + 1:2, // ERROR "cannot use 1.*as type string in map key|incompatible type" +} diff --git a/gcc/testsuite/go.test/test/golden.out b/gcc/testsuite/go.test/test/golden.out index 655ceda5653..e0b4cf6e2a7 100644 --- a/gcc/testsuite/go.test/test/golden.out +++ b/gcc/testsuite/go.test/test/golden.out @@ -1,166 +1,19 @@ == ./ -=========== ./cmp2.go -panic: runtime error: comparing uncomparable type []int - - -=========== ./cmp3.go -panic: runtime error: comparing uncomparable type []int - - -=========== ./cmp4.go -panic: runtime error: hash of unhashable type []int - - -=========== ./cmp5.go -panic: runtime error: hash of unhashable type []int - - -=========== ./deferprint.go -printing: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 -42 true false true +1.500000e+000 world 0x0 [0/0]0x0 0x0 0x0 255 - -=========== ./goprint.go -42 true false true +1.500000e+000 world 0x0 [0/0]0x0 0x0 0x0 255 - -=========== ./helloworld.go -hello, world - -=========== ./peano.go -0! = 1 -1! = 1 -2! = 2 -3! = 6 -4! = 24 -5! = 120 -6! = 720 -7! = 5040 -8! = 40320 -9! = 362880 - -=========== ./printbig.go --9223372036854775808 -9223372036854775807 - -=========== ./sigchld.go -survived SIGCHLD - -=========== ./sinit.go -FAIL - -=========== ./turing.go -Hello World! - == ken/ -=========== ken/cplx0.go -(+5.000000e+000+6.000000e+000i) -(+5.000000e+000+6.000000e+000i) -(+5.000000e+000+6.000000e+000i) -(+5.000000e+000+6.000000e+000i) - -=========== ken/cplx3.go -(+1.292308e+000-1.384615e-001i) -(+1.292308e+000-1.384615e-001i) - -=========== ken/cplx4.go -c = (-5.000000-6.000000i) -c = (5.000000+6.000000i) -c = (5.000000+6.000000i) -c = (5.000000+6.000000i) -c = (5+6i) -c = (13+7i) - -=========== ken/cplx5.go -(+5.000000e+000-5.000000e+000i) -(+5.000000e+000-5.000000e+000i) -(+5.000000e+000-5.000000e+000i) -(+5.000000e+000-5.000000e+000i) -(+5.000000e+000-5.000000e+000i) -(+5.000000e+000-5.000000e+000i) -(+5.000000e+000-5.000000e+000i) - -=========== ken/intervar.go - print 1 bio 2 file 3 -- abc - -=========== ken/label.go -100 - -=========== ken/rob1.go -9876543210 - -=========== ken/rob2.go -(defn foo (add 12 34)) - -=========== ken/simpprint.go -hello world - -=========== ken/simpswitch.go -0out01out12out2aout34out4fiveout56out6aout78out89out9 - -=========== ken/string.go -abcxyz-abcxyz-abcxyz-abcxyz-abcxyz-abcxyz-abcxyz - == chan/ -=========== chan/doubleselect.go -PASS - -=========== chan/nonblock.go -PASS - == interface/ -=========== interface/fail.go -panic: interface conversion: *main.S is not main.I: missing method Foo - - -=========== interface/returntype.go -panic: interface conversion: *main.S is not main.I2: missing method Name - - -== nilptr/ - == syntax/ -== fixedbugs/ - -=========== fixedbugs/bug027.go -hi -0 44444 -1 3333 -2 222 -3 11 -4 0 -0 44444 -1 3333 -2 222 -3 11 -4 0 - -=========== fixedbugs/bug067.go -ok - -=========== fixedbugs/bug070.go -outer loop top k 0 -inner loop top i 0 -do break -broke - -=========== fixedbugs/bug093.go -M - -=========== fixedbugs/bug113.go -panic: interface conversion: interface is int, not int32 +== dwarf/ - -=========== fixedbugs/bug148.go -2 3 -panic: interface conversion: interface is main.T, not main.T - - -=========== fixedbugs/bug328.go -0x0 +== fixedbugs/ == bugs/ + +=========== bugs/bug395.go +bug395 is broken diff --git a/gcc/testsuite/go.test/test/goprint.go b/gcc/testsuite/go.test/test/goprint.go index c0e34c750e3..53ed055a070 100644 --- a/gcc/testsuite/go.test/test/goprint.go +++ b/gcc/testsuite/go.test/test/goprint.go @@ -1,4 +1,4 @@ -// $G $D/$F.go && $L $F.$A && ./$A.out +// $G $D/$F.go && $L $F.$A && ./$A.out 2>&1 | cmp - $D/$F.out // Copyright 2011 The Go Authors. All rights reserved. // Use of this source code is governed by a BSD-style diff --git a/gcc/testsuite/go.test/test/goprint.out b/gcc/testsuite/go.test/test/goprint.out new file mode 100644 index 00000000000..da3919ed64f --- /dev/null +++ b/gcc/testsuite/go.test/test/goprint.out @@ -0,0 +1 @@ +42 true false true +1.500000e+000 world 0x0 [0/0]0x0 0x0 0x0 255 diff --git a/gcc/testsuite/go.test/test/helloworld.go b/gcc/testsuite/go.test/test/helloworld.go index e55a74bbd36..16c95f00686 100644 --- a/gcc/testsuite/go.test/test/helloworld.go +++ b/gcc/testsuite/go.test/test/helloworld.go @@ -1,4 +1,4 @@ -// $G $F.go && $L $F.$A && ./$A.out +// $G $F.go && $L $F.$A && ./$A.out 2>&1 | cmp - $D/$F.out // Copyright 2009 The Go Authors. All rights reserved. // Use of this source code is governed by a BSD-style diff --git a/gcc/testsuite/go.test/test/helloworld.out b/gcc/testsuite/go.test/test/helloworld.out new file mode 100644 index 00000000000..4b5fa63702d --- /dev/null +++ b/gcc/testsuite/go.test/test/helloworld.out @@ -0,0 +1 @@ +hello, world diff --git a/gcc/testsuite/go.test/test/init1.go b/gcc/testsuite/go.test/test/init1.go new file mode 100644 index 00000000000..9ce3c12ee68 --- /dev/null +++ b/gcc/testsuite/go.test/test/init1.go @@ -0,0 +1,44 @@ +// $G $D/$F.go && $L $F.$A && ./$A.out + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Test that goroutines and garbage collection run during init. + +package main + +import "runtime" + +var x []byte + +func init() { + c := make(chan int) + go send(c) + <-c + + const chunk = 1<<20 + runtime.UpdateMemStats() + sys := runtime.MemStats.Sys + b := make([]byte, chunk) + for i := range b { + b[i] = byte(i%10 + '0') + } + s := string(b) + for i := 0; i < 1000; i++ { + x = []byte(s) + } + runtime.UpdateMemStats() + sys1 := runtime.MemStats.Sys + if sys1-sys > chunk*50 { + println("allocated 1000 chunks of", chunk, "and used ", sys1-sys, "memory") + } +} + +func send(c chan int) { + c <- 1 +} + +func main() { +} + diff --git a/gcc/testsuite/go.test/test/interface/fail.go b/gcc/testsuite/go.test/test/interface/fail.go index 3e741d3f91a..0c20bcf756a 100644 --- a/gcc/testsuite/go.test/test/interface/fail.go +++ b/gcc/testsuite/go.test/test/interface/fail.go @@ -1,4 +1,4 @@ -// $G $D/$F.go && $L $F.$A && ! ./$A.out +// $G $D/$F.go && $L $F.$A && ./$A.out // Copyright 2009 The Go Authors. All rights reserved. // Use of this source code is governed by a BSD-style @@ -13,6 +13,10 @@ type I interface { } func main() { + shouldPanic(p1) +} + +func p1() { var s *S var i I var e interface {} @@ -21,6 +25,14 @@ func main() { _ = i } -// hide S down here to avoid static warning type S struct { } + +func shouldPanic(f func()) { + defer func() { + if recover() == nil { + panic("function should panic") + } + }() + f() +} diff --git a/gcc/testsuite/go.test/test/interface/noeq.go b/gcc/testsuite/go.test/test/interface/noeq.go new file mode 100644 index 00000000000..3c2ea5975a1 --- /dev/null +++ b/gcc/testsuite/go.test/test/interface/noeq.go @@ -0,0 +1,39 @@ +// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: interface/noeq + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Interface values containing types that cannot be compared for equality. + +package main + +func main() { + cmp(1) + + var ( + m map[int]int + s struct{ x []int } + f func() + ) + noCmp(m) + noCmp(s) + noCmp(f) +} + +func cmp(x interface{}) bool { + return x == x +} + +func noCmp(x interface{}) { + shouldPanic(func() { cmp(x) }) +} + +func shouldPanic(f func()) { + defer func() { + if recover() == nil { + panic("function should panic") + } + }() + f() +} diff --git a/gcc/testsuite/go.test/test/interface/recursive1.go b/gcc/testsuite/go.test/test/interface/recursive1.go new file mode 100644 index 00000000000..2c93a28363a --- /dev/null +++ b/gcc/testsuite/go.test/test/interface/recursive1.go @@ -0,0 +1,15 @@ +// true # used by recursive2 + +// Copyright 2012 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package p + +type I1 interface { + F() I2 +} + +type I2 interface { + I1 +} diff --git a/gcc/testsuite/go.test/test/interface/recursive2.go b/gcc/testsuite/go.test/test/interface/recursive2.go new file mode 100644 index 00000000000..a7f9ab5dbd9 --- /dev/null +++ b/gcc/testsuite/go.test/test/interface/recursive2.go @@ -0,0 +1,22 @@ +// $G $D/recursive1.go && $G $D/$F.go + +// Copyright 2012 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Check that the mutually recursive types in recursive1.go made it +// intact and with the same meaning, by assigning to or using them. + +package main + +import "./recursive1" + +func main() { + var i1 p.I1 + var i2 p.I2 + i1 = i2 + i2 = i1 + i1 = i2.F() + i2 = i1.F() + _, _ = i1, i2 +} diff --git a/gcc/testsuite/go.test/test/interface/returntype.go b/gcc/testsuite/go.test/test/interface/returntype.go index c526b3b0ece..5cf08361781 100644 --- a/gcc/testsuite/go.test/test/interface/returntype.go +++ b/gcc/testsuite/go.test/test/interface/returntype.go @@ -1,4 +1,4 @@ -// $G $D/$F.go && $L $F.$A && (! ./$A.out || echo BUG: should not succeed) +// $G $D/$F.go && $L $F.$A && ./$A.out // Copyright 2009 The Go Authors. All rights reserved. // Use of this source code is governed by a BSD-style @@ -18,8 +18,21 @@ type I1 interface { Name() int8 } type I2 interface { Name() int64 } func main() { + shouldPanic(p1) +} + +func p1() { var i1 I1 var s *S i1 = s print(i1.(I2).Name()) } + +func shouldPanic(f func()) { + defer func() { + if recover() == nil { + panic("function should panic") + } + }() + f() +} diff --git a/gcc/testsuite/go.test/test/ken/cplx0.go b/gcc/testsuite/go.test/test/ken/cplx0.go index ba1fa196fd6..f38ce5b65d1 100644 --- a/gcc/testsuite/go.test/test/ken/cplx0.go +++ b/gcc/testsuite/go.test/test/ken/cplx0.go @@ -1,4 +1,4 @@ -// $G $D/$F.go && $L $F.$A && ./$A.out +// $G $D/$F.go && $L $F.$A && ./$A.out 2>&1 | cmp - $D/$F.out // Copyright 2010 The Go Authors. All rights reserved. // Use of this source code is governed by a BSD-style diff --git a/gcc/testsuite/go.test/test/ken/cplx0.out b/gcc/testsuite/go.test/test/ken/cplx0.out new file mode 100644 index 00000000000..7627c28df7a --- /dev/null +++ b/gcc/testsuite/go.test/test/ken/cplx0.out @@ -0,0 +1,4 @@ +(+5.000000e+000+6.000000e+000i) +(+5.000000e+000+6.000000e+000i) +(+5.000000e+000+6.000000e+000i) +(+5.000000e+000+6.000000e+000i) diff --git a/gcc/testsuite/go.test/test/ken/cplx2.go b/gcc/testsuite/go.test/test/ken/cplx2.go index b36e93ecd66..89f4a04181e 100644 --- a/gcc/testsuite/go.test/test/ken/cplx2.go +++ b/gcc/testsuite/go.test/test/ken/cplx2.go @@ -105,4 +105,16 @@ func main() { println("opcode x", ce, Ce) panic("fail") } + + r32 := real(complex64(ce)) + if r32 != float32(real(Ce)) { + println("real(complex64(ce))", r32, real(Ce)) + panic("fail") + } + + r64 := real(complex128(ce)) + if r64 != real(Ce) { + println("real(complex128(ce))", r64, real(Ce)) + panic("fail") + } } diff --git a/gcc/testsuite/go.test/test/ken/cplx3.go b/gcc/testsuite/go.test/test/ken/cplx3.go index fa6ff1d52ee..048c93eef67 100644 --- a/gcc/testsuite/go.test/test/ken/cplx3.go +++ b/gcc/testsuite/go.test/test/ken/cplx3.go @@ -19,10 +19,29 @@ const ( func main() { c0 := C1 c0 = (c0 + c0 + c0) / (c0 + c0 + 3i) - println(c0) + r, i := real(c0), imag(c0) + d := r - 1.292308 + if d < 0 { + d = - d + } + if d > 1e-6 { + println(r, "!= 1.292308") + panic(0) + } + d = i + 0.1384615 + if d < 0 { + d = - d + } + if d > 1e-6 { + println(i, "!= -0.1384615") + panic(0) + } c := *(*complex128)(unsafe.Pointer(&c0)) - println(c) + if c != c0 { + println(c, "!=", c) + panic(0) + } var a interface{} switch c := reflect.ValueOf(a); c.Kind() { diff --git a/gcc/testsuite/go.test/test/ken/cplx4.go b/gcc/testsuite/go.test/test/ken/cplx4.go index 8524e47aec3..738afcd2cad 100644 --- a/gcc/testsuite/go.test/test/ken/cplx4.go +++ b/gcc/testsuite/go.test/test/ken/cplx4.go @@ -15,30 +15,44 @@ const ( C1 = R + I // ADD(5,6) ) -func doprint(c complex128) { fmt.Printf("c = %f\n", c) } +func want(s, w string) { + if s != w { + panic(s + " != " + w) + } +} + +func doprint(c complex128, w string) { + s := fmt.Sprintf("%f", c) + want(s, w) +} func main() { // constants - fmt.Printf("c = %f\n", -C1) - doprint(C1) + s := fmt.Sprintf("%f", -C1) + want(s, "(-5.000000-6.000000i)") + doprint(C1, "(5.000000+6.000000i)") // variables c1 := C1 - fmt.Printf("c = %f\n", c1) - doprint(c1) + s = fmt.Sprintf("%f", c1) + want(s, "(5.000000+6.000000i)") + doprint(c1, "(5.000000+6.000000i)") // 128 c2 := complex128(C1) - fmt.Printf("c = %G\n", c2) + s = fmt.Sprintf("%G", c2) + want(s, "(5+6i)") // real, imag, complex c3 := complex(real(c2)+3, imag(c2)-5) + c2 - fmt.Printf("c = %G\n", c3) + s = fmt.Sprintf("%G", c3) + want(s, "(13+7i)") // compiler used to crash on nested divide c4 := complex(real(c3/2), imag(c3/2)) if c4 != c3/2 { fmt.Printf("BUG: c3 = %G != c4 = %G\n", c3, c4) + panic(0) } } diff --git a/gcc/testsuite/go.test/test/ken/cplx5.go b/gcc/testsuite/go.test/test/ken/cplx5.go index d425a7c4c04..e6696674b0a 100644 --- a/gcc/testsuite/go.test/test/ken/cplx5.go +++ b/gcc/testsuite/go.test/test/ken/cplx5.go @@ -19,36 +19,52 @@ func main() { for i := 0; i < len(a); i++ { a[i] = complex(float64(i), float64(-i)) } - println(a[5]) + if a[5] != 5-5i { + panic(a[5]) + } // slice of complex128 s = make([]complex128, len(a)) for i := 0; i < len(s); i++ { s[i] = a[i] } - println(s[5]) + if s[5] != 5-5i { + panic(s[5]) + } // chan c = make(chan complex128) go chantest(c) - println(<-c) + vc := <-c + if vc != 5-5i { + panic(vc) + } // pointer of complex128 v := a[5] pv := &v - println(*pv) + if *pv != 5-5i { + panic(*pv) + } // field of complex128 f.c = a[5] - println(f.c) + if f.c != 5-5i { + panic(f.c) + } // map of complex128 m = make(map[complex128]complex128) for i := 0; i < len(s); i++ { m[-a[i]] = a[i] } - println(m[5i-5]) - println(m[complex(-5, 5)]) + if m[5i-5] != 5-5i { + panic(m[5i-5]) + } + vm := m[complex(-5, 5)] + if vm != 5-5i { + panic(vm) + } } func chantest(c chan complex128) { c <- a[5] } diff --git a/gcc/testsuite/go.test/test/ken/intervar.go b/gcc/testsuite/go.test/test/ken/intervar.go index c2aaaa87051..73d1b0660bd 100644 --- a/gcc/testsuite/go.test/test/ken/intervar.go +++ b/gcc/testsuite/go.test/test/ken/intervar.go @@ -7,7 +7,7 @@ package main type Iputs interface { - puts (s string); + puts (s string) string; } // --------- @@ -17,9 +17,9 @@ type Print struct { put Iputs; } -func (p *Print) dop() { - print(" print ", p.whoami); - p.put.puts("abc"); +func (p *Print) dop() string { + r := " print " + string(p.whoami + '0') + return r + p.put.puts("abc"); } // --------- @@ -29,9 +29,9 @@ type Bio struct { put Iputs; } -func (b *Bio) puts(s string) { - print(" bio ", b.whoami); - b.put.puts(s); +func (b *Bio) puts(s string) string { + r := " bio " + string(b.whoami + '0') + return r + b.put.puts(s); } // --------- @@ -41,8 +41,8 @@ type File struct { put Iputs; } -func (f *File) puts(s string) { - print(" file ", f.whoami, " -- ", s); +func (f *File) puts(s string) string { + return " file " + string(f.whoami + '0') + " -- " + s } func @@ -59,6 +59,9 @@ main() { f.whoami = 3; - p.dop(); - print("\n"); + r := p.dop(); + expected := " print 1 bio 2 file 3 -- abc" + if r != expected { + panic(r + " != " + expected) + } } diff --git a/gcc/testsuite/go.test/test/ken/label.go b/gcc/testsuite/go.test/test/ken/label.go index 770f33e39f7..7a509f0484a 100644 --- a/gcc/testsuite/go.test/test/ken/label.go +++ b/gcc/testsuite/go.test/test/ken/label.go @@ -4,33 +4,29 @@ // Use of this source code is governed by a BSD-style // license that can be found in the LICENSE file. - package main -func -main() { - i := 0; +func main() { + i := 0 if false { - goto gogoloop; + goto gogoloop } if false { - goto gogoloop; + goto gogoloop } if false { - goto gogoloop; + goto gogoloop } - goto gogoloop; + goto gogoloop -// backward declared + // backward declared loop: - i = i+1; + i = i + 1 if i < 100 { - goto loop; + goto loop } - print(i); - print("\n"); - return; + return gogoloop: - goto loop; + goto loop } diff --git a/gcc/testsuite/go.test/test/ken/rob1.go b/gcc/testsuite/go.test/test/ken/rob1.go index 03350662a2e..a5854b93e2f 100644 --- a/gcc/testsuite/go.test/test/ken/rob1.go +++ b/gcc/testsuite/go.test/test/ken/rob1.go @@ -7,61 +7,64 @@ package main type Item interface { - Print(); + Print() string } type ListItem struct { - item Item; - next *ListItem; + item Item + next *ListItem } type List struct { - head *ListItem; + head *ListItem } func (list *List) Init() { - list.head = nil; + list.head = nil } func (list *List) Insert(i Item) { - item := new(ListItem); - item.item = i; - item.next = list.head; - list.head = item; + item := new(ListItem) + item.item = i + item.next = list.head + list.head = item } -func (list *List) Print() { - i := list.head; +func (list *List) Print() string { + r := "" + i := list.head for i != nil { - i.item.Print(); - i = i.next; + r += i.item.Print() + i = i.next } + return r } // Something to put in a list type Integer struct { - val int; + val int } func (this *Integer) Init(i int) *Integer { - this.val = i; - return this; + this.val = i + return this } -func (this *Integer) Print() { - print(this.val); +func (this *Integer) Print() string { + return string(this.val + '0') } -func -main() { - list := new(List); - list.Init(); +func main() { + list := new(List) + list.Init() for i := 0; i < 10; i = i + 1 { - integer := new(Integer); - integer.Init(i); - list.Insert(integer); + integer := new(Integer) + integer.Init(i) + list.Insert(integer) } - list.Print(); - print("\n"); + r := list.Print() + if r != "9876543210" { + panic(r) + } } diff --git a/gcc/testsuite/go.test/test/ken/rob2.go b/gcc/testsuite/go.test/test/ken/rob2.go index af63e4d9f6d..d13e2441d40 100644 --- a/gcc/testsuite/go.test/test/ken/rob2.go +++ b/gcc/testsuite/go.test/test/ken/rob2.go @@ -4,269 +4,274 @@ // Use of this source code is governed by a BSD-style // license that can be found in the LICENSE file. - package main -const nilchar = 0; +import "fmt" + +const nilchar = 0 type Atom struct { - str string; - integer int; - next *Slist; /* in hash bucket */ + str string + integer int + next *Slist /* in hash bucket */ } type List struct { - car *Slist; - cdr*Slist; + car *Slist + cdr *Slist } type Slist struct { - isatom bool; - isstring bool; + isatom bool + isstring bool //union { - atom Atom; - list List; + atom Atom + list List //} u; } func (this *Slist) Car() *Slist { - return this.list.car; + return this.list.car } func (this *Slist) Cdr() *Slist { - return this.list.cdr; + return this.list.cdr } func (this *Slist) String() string { - return this.atom.str; + return this.atom.str } func (this *Slist) Integer() int { - return this.atom.integer; + return this.atom.integer } func (slist *Slist) Free() { if slist == nil { - return; + return } if slist.isatom { -// free(slist.String()); + // free(slist.String()); } else { - slist.Car().Free(); - slist.Cdr().Free(); + slist.Car().Free() + slist.Cdr().Free() } -// free(slist); + // free(slist); } //Slist* atom(byte *s, int i); -var token int; -var peekc int = -1; -var lineno int32 = 1; +var token int +var peekc int = -1 +var lineno int32 = 1 -var input string; -var inputindex int = 0; -var tokenbuf [100]byte; -var tokenlen int = 0; +var input string +var inputindex int = 0 +var tokenbuf [100]byte +var tokenlen int = 0 -const EOF int = -1; +const EOF int = -1 func main() { - var list *Slist; + var list *Slist - OpenFile(); - for ;; { - list = Parse(); + OpenFile() + for { + list = Parse() if list == nil { - break; + break + } + r := list.Print() + list.Free() + if r != "(defn foo (add 12 34))" { + panic(r) } - list.Print(); - list.Free(); - break; + break } } -func (slist *Slist) PrintOne(doparen bool) { +func (slist *Slist) PrintOne(doparen bool) string { if slist == nil { - return; + return "" } + var r string if slist.isatom { if slist.isstring { - print(slist.String()); + r = slist.String() } else { - print(slist.Integer()); + r = fmt.Sprintf("%v", slist.Integer()) } } else { if doparen { - print("(" ); + r += "(" } - slist.Car().PrintOne(true); + r += slist.Car().PrintOne(true) if slist.Cdr() != nil { - print(" "); - slist.Cdr().PrintOne(false); + r += " " + r += slist.Cdr().PrintOne(false) } if doparen { - print(")"); + r += ")" } } + return r } -func (slist *Slist) Print() { - slist.PrintOne(true); - print("\n"); +func (slist *Slist) Print() string { + return slist.PrintOne(true) } func Get() int { - var c int; + var c int if peekc >= 0 { - c = peekc; - peekc = -1; + c = peekc + peekc = -1 } else { - c = int(input[inputindex]); - inputindex++; + c = int(input[inputindex]) + inputindex++ if c == '\n' { - lineno = lineno + 1; + lineno = lineno + 1 } if c == nilchar { - inputindex = inputindex - 1; - c = EOF; + inputindex = inputindex - 1 + c = EOF } } - return c; + return c } func WhiteSpace(c int) bool { - return c == ' ' || c == '\t' || c == '\r' || c == '\n'; + return c == ' ' || c == '\t' || c == '\r' || c == '\n' } func NextToken() { - var i, c int; + var i, c int - tokenbuf[0] = nilchar; // clear previous token - c = Get(); + tokenbuf[0] = nilchar // clear previous token + c = Get() for WhiteSpace(c) { - c = Get(); + c = Get() } switch c { case EOF: - token = EOF; + token = EOF case '(', ')': - token = c; - break; + token = c + break default: - for i = 0; i < 100 - 1; { // sizeof tokenbuf - 1 - tokenbuf[i] = byte(c); - i = i + 1; - c = Get(); + for i = 0; i < 100-1; { // sizeof tokenbuf - 1 + tokenbuf[i] = byte(c) + i = i + 1 + c = Get() if c == EOF { - break; + break } if WhiteSpace(c) || c == ')' { - peekc = c; - break; + peekc = c + break } } - if i >= 100 - 1 { // sizeof tokenbuf - 1 - panic("atom too long\n"); + if i >= 100-1 { // sizeof tokenbuf - 1 + panic("atom too long\n") } - tokenlen = i; - tokenbuf[i] = nilchar; + tokenlen = i + tokenbuf[i] = nilchar if '0' <= tokenbuf[0] && tokenbuf[0] <= '9' { - token = '0'; + token = '0' } else { - token = 'A'; + token = 'A' } } } func Expect(c int) { if token != c { - print("parse error: expected ", c, "\n"); - panic("parse"); + print("parse error: expected ", c, "\n") + panic("parse") } - NextToken(); + NextToken() } // Parse a non-parenthesized list up to a closing paren or EOF func ParseList() *Slist { - var slist, retval *Slist; - - slist = new(Slist); - slist.list.car = nil; - slist.list.cdr = nil; - slist.isatom = false; - slist.isstring = false; - - retval = slist; - for ;; { - slist.list.car = Parse(); - if token == ')' || token == EOF { // empty cdr - break; + var slist, retval *Slist + + slist = new(Slist) + slist.list.car = nil + slist.list.cdr = nil + slist.isatom = false + slist.isstring = false + + retval = slist + for { + slist.list.car = Parse() + if token == ')' || token == EOF { // empty cdr + break } - slist.list.cdr = new(Slist); - slist = slist.list.cdr; + slist.list.cdr = new(Slist) + slist = slist.list.cdr } - return retval; + return retval } -func atom(i int) *Slist { // BUG: uses tokenbuf; should take argument) - var slist *Slist; +func atom(i int) *Slist { // BUG: uses tokenbuf; should take argument) + var slist *Slist - slist = new(Slist); + slist = new(Slist) if token == '0' { - slist.atom.integer = i; - slist.isstring = false; + slist.atom.integer = i + slist.isstring = false } else { - slist.atom.str = string(tokenbuf[0:tokenlen]); - slist.isstring = true; + slist.atom.str = string(tokenbuf[0:tokenlen]) + slist.isstring = true } - slist.isatom = true; - return slist; + slist.isatom = true + return slist } -func atoi() int { // BUG: uses tokenbuf; should take argument) - var v int = 0; +func atoi() int { // BUG: uses tokenbuf; should take argument) + var v int = 0 for i := 0; i < tokenlen && '0' <= tokenbuf[i] && tokenbuf[i] <= '9'; i = i + 1 { - v = 10 * v + int(tokenbuf[i] - '0'); + v = 10*v + int(tokenbuf[i]-'0') } - return v; + return v } func Parse() *Slist { - var slist *Slist; + var slist *Slist if token == EOF || token == ')' { - return nil; + return nil } if token == '(' { - NextToken(); - slist = ParseList(); - Expect(')'); - return slist; + NextToken() + slist = ParseList() + Expect(')') + return slist } else { // Atom switch token { case EOF: - return nil; + return nil case '0': - slist = atom(atoi()); + slist = atom(atoi()) case '"', 'A': - slist = atom(0); + slist = atom(0) default: - slist = nil; - print("unknown token: ", token, "\n"); + slist = nil + print("unknown token: ", token, "\n") } - NextToken(); - return slist; + NextToken() + return slist } - return nil; + return nil } func OpenFile() { - input = "(defn foo (add 12 34))\n\x00"; - inputindex = 0; - peekc = -1; // BUG - NextToken(); + input = "(defn foo (add 12 34))\n\x00" + inputindex = 0 + peekc = -1 // BUG + NextToken() } diff --git a/gcc/testsuite/go.test/test/ken/simpprint.go b/gcc/testsuite/go.test/test/ken/simpprint.go deleted file mode 100644 index 6077f7eb025..00000000000 --- a/gcc/testsuite/go.test/test/ken/simpprint.go +++ /dev/null @@ -1,13 +0,0 @@ -// $G $D/$F.go && $L $F.$A && ./$A.out - -// Copyright 2009 The Go Authors. All rights reserved. -// Use of this source code is governed by a BSD-style -// license that can be found in the LICENSE file. - - -package main - -func -main() { - print("hello world\n"); -} diff --git a/gcc/testsuite/go.test/test/ken/simpswitch.go b/gcc/testsuite/go.test/test/ken/simpswitch.go index ab5dd356b3e..710af2e08c6 100644 --- a/gcc/testsuite/go.test/test/ken/simpswitch.go +++ b/gcc/testsuite/go.test/test/ken/simpswitch.go @@ -6,19 +6,21 @@ package main -func -main() { - a := 3; - for i:=0; i<10; i=i+1 { - switch(i) { +func main() { + r := "" + a := 3 + for i := 0; i < 10; i = i + 1 { + switch i { case 5: - print("five"); - case a,7: - print("a"); + r += "five" + case a, 7: + r += "a" default: - print(i); + r += string(i + '0') } - print("out", i); + r += "out" + string(i+'0') + } + if r != "0out01out12out2aout34out4fiveout56out6aout78out89out9" { + panic(r) } - print("\n"); } diff --git a/gcc/testsuite/go.test/test/ken/string.go b/gcc/testsuite/go.test/test/ken/string.go index b74bd7d6f1c..e0510824293 100644 --- a/gcc/testsuite/go.test/test/ken/string.go +++ b/gcc/testsuite/go.test/test/ken/string.go @@ -1,4 +1,4 @@ -// $G $D/$F.go && $L $F.$A && ./$A.out +// $G $D/$F.go && $L $F.$A && ./$A.out 2>&1 | cmp - $D/$F.out // Copyright 2009 The Go Authors. All rights reserved. // Use of this source code is governed by a BSD-style @@ -71,16 +71,14 @@ func main() { /* create string with integer constant */ c = string('x') if c != "x" { - print("create int ", c) - panic("fail") + panic("create int " + c) } /* create string with integer variable */ v := 'x' c = string(v) if c != "x" { - print("create int ", c) - panic("fail") + panic("create int " + c) } /* create string with byte array */ @@ -90,8 +88,7 @@ func main() { z1[2] = 'c' c = string(z1[0:]) if c != "abc" { - print("create byte array ", c) - panic("fail") + panic("create byte array " + c) } /* create string with int array */ @@ -101,8 +98,7 @@ func main() { z2[2] = 'c' c = string(z2[0:]) if c != "a\u1234c" { - print("create int array ", c) - panic("fail") + panic("create int array " + c) } /* create string with byte array pointer */ @@ -112,7 +108,6 @@ func main() { z3[2] = 'c' c = string(z3[0:]) if c != "abc" { - print("create array pointer ", c) - panic("fail") + panic("create array pointer " + c) } } diff --git a/gcc/testsuite/go.test/test/ken/string.out b/gcc/testsuite/go.test/test/ken/string.out new file mode 100644 index 00000000000..8bc36bc6f53 --- /dev/null +++ b/gcc/testsuite/go.test/test/ken/string.out @@ -0,0 +1 @@ +abcxyz-abcxyz-abcxyz-abcxyz-abcxyz-abcxyz-abcxyz diff --git a/gcc/testsuite/go.test/test/mallocfin.go b/gcc/testsuite/go.test/test/mallocfin.go index dc6d74bad68..ff62392473d 100644 --- a/gcc/testsuite/go.test/test/mallocfin.go +++ b/gcc/testsuite/go.test/test/mallocfin.go @@ -47,18 +47,28 @@ func finalB(b *B) { nfinal++ } +func nofinalB(b *B) { + panic("nofinalB run") +} + func main() { runtime.GOMAXPROCS(4) for i = 0; i < N; i++ { b := &B{i} a := &A{b, i} + c := new(B) + runtime.SetFinalizer(c, nofinalB) runtime.SetFinalizer(b, finalB) runtime.SetFinalizer(a, finalA) + runtime.SetFinalizer(c, nil) } for i := 0; i < N; i++ { runtime.GC() runtime.Gosched() time.Sleep(1e6) + if nfinal >= N*8/10 { + break + } } if nfinal < N*8/10 { println("not enough finalizing:", nfinal, "/", N) diff --git a/gcc/testsuite/go.test/test/mallocrep.go b/gcc/testsuite/go.test/test/mallocrep.go index 9f47e52e2b6..cffcd1638fc 100644 --- a/gcc/testsuite/go.test/test/mallocrep.go +++ b/gcc/testsuite/go.test/test/mallocrep.go @@ -33,6 +33,7 @@ func bigger() { func main() { runtime.GC() // clean up garbage from init + runtime.UpdateMemStats() // first call can do some allocations runtime.MemProfileRate = 0 // disable profiler runtime.MemStats.Alloc = 0 // ignore stacks flag.Parse() diff --git a/gcc/testsuite/go.test/test/map1.go b/gcc/testsuite/go.test/test/map1.go new file mode 100644 index 00000000000..6af10565cd1 --- /dev/null +++ b/gcc/testsuite/go.test/test/map1.go @@ -0,0 +1,41 @@ +// errchk $G -e $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package main + +func main() {} + +type v bool + +var ( + // valid + _ map[int8]v + _ map[uint8]v + _ map[int16]v + _ map[uint16]v + _ map[int32]v + _ map[uint32]v + _ map[int64]v + _ map[uint64]v + _ map[int]v + _ map[uint]v + _ map[uintptr]v + _ map[float32]v + _ map[float64]v + _ map[complex64]v + _ map[complex128]v + _ map[bool]v + _ map[string]v + _ map[chan int]v + _ map[*int]v + _ map[struct{}]v + _ map[[10]int]v + + // invalid + _ map[[]int]v // ERROR "invalid map key" + _ map[func()]v // ERROR "invalid map key" + _ map[map[int]int]v // ERROR "invalid map key" +) diff --git a/gcc/testsuite/go.test/test/nil.go b/gcc/testsuite/go.test/test/nil.go index 30cc2705b03..efcf4f7822b 100644 --- a/gcc/testsuite/go.test/test/nil.go +++ b/gcc/testsuite/go.test/test/nil.go @@ -150,7 +150,7 @@ func maptest() { m[2] = 3 }) shouldPanic(func() { - m[2] = 0, false + delete(m, 2) }) } diff --git a/gcc/testsuite/go.test/test/nilptr.go b/gcc/testsuite/go.test/test/nilptr.go new file mode 100644 index 00000000000..b0c1df2d95c --- /dev/null +++ b/gcc/testsuite/go.test/test/nilptr.go @@ -0,0 +1,129 @@ +// $G $D/$F.go && $L $F.$A && ./$A.out + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package main + +import "unsafe" + +// Having a big address space means that indexing +// at a 256 MB offset from a nil pointer might not +// cause a memory access fault. This test checks +// that Go is doing the correct explicit checks to catch +// these nil pointer accesses, not just relying on the hardware. +var dummy [256 << 20]byte // give us a big address space + +func main() { + // the test only tests what we intend to test + // if dummy starts in the first 256 MB of memory. + // otherwise there might not be anything mapped + // at the address that might be accidentally + // dereferenced below. + if uintptr(unsafe.Pointer(&dummy)) > 256<<20 { + panic("dummy too far out") + } + + shouldPanic(p1) + shouldPanic(p2) + shouldPanic(p3) + shouldPanic(p4) + shouldPanic(p5) + shouldPanic(p6) + shouldPanic(p7) + shouldPanic(p8) + shouldPanic(p9) + shouldPanic(p10) +} + +func shouldPanic(f func()) { + defer func() { + if recover() == nil { + panic("memory reference did not panic") + } + }() + f() +} + +func p1() { + // Array index. + var p *[1 << 30]byte = nil + println(p[256<<20]) // very likely to be inside dummy, but should panic +} + +var xb byte + +func p2() { + var p *[1 << 30]byte = nil + xb = 123 + + // Array index. + println(p[uintptr(unsafe.Pointer(&xb))]) // should panic +} + +func p3() { + // Array to slice. + var p *[1 << 30]byte = nil + var x []byte = p[0:] // should panic + _ = x +} + +var q *[1 << 30]byte + +func p4() { + // Array to slice. + var x []byte + var y = &x + *y = q[0:] // should crash (uses arraytoslice runtime routine) +} + +func fb([]byte) { + panic("unreachable") +} + +func p5() { + // Array to slice. + var p *[1 << 30]byte = nil + fb(p[0:]) // should crash +} + +func p6() { + // Array to slice. + var p *[1 << 30]byte = nil + var _ []byte = p[10 : len(p)-10] // should crash +} + +type T struct { + x [256 << 20]byte + i int +} + +func f() *T { + return nil +} + +var y *T +var x = &y + +func p7() { + // Struct field access with large offset. + println(f().i) // should crash +} + +func p8() { + // Struct field access with large offset. + println((*x).i) // should crash +} + +func p9() { + // Struct field access with large offset. + var t *T + println(&t.i) // should crash +} + +func p10() { + // Struct field access with large offset. + var t *T + println(t.i) // should crash +} diff --git a/gcc/testsuite/go.test/test/nilptr/arrayindex.go b/gcc/testsuite/go.test/test/nilptr/arrayindex.go deleted file mode 100644 index fa26532c67b..00000000000 --- a/gcc/testsuite/go.test/test/nilptr/arrayindex.go +++ /dev/null @@ -1,26 +0,0 @@ -// $G $D/$F.go && $L $F.$A && -// ((! sh -c ./$A.out) >/dev/null 2>&1 || echo BUG: should fail) - -// Copyright 2009 The Go Authors. All rights reserved. -// Use of this source code is governed by a BSD-style -// license that can be found in the LICENSE file. - -package main - -import "unsafe" - -var x byte - -func main() { - var p *[1<<30]byte = nil - x = 123 - - // The problem here is not the use of unsafe: - // it is that indexing into p[] with a large - // enough index jumps out of the unmapped section - // at the beginning of memory and into valid memory. - // Pointer offsets and array indices, if they are - // very large, need to dereference the base pointer - // to trigger a trap. - println(p[uintptr(unsafe.Pointer(&x))]) // should crash -} diff --git a/gcc/testsuite/go.test/test/nilptr/arrayindex1.go b/gcc/testsuite/go.test/test/nilptr/arrayindex1.go deleted file mode 100644 index 64f46e14d19..00000000000 --- a/gcc/testsuite/go.test/test/nilptr/arrayindex1.go +++ /dev/null @@ -1,31 +0,0 @@ -// $G $D/$F.go && $L $F.$A && -// ((! sh -c ./$A.out) >/dev/null 2>&1 || echo BUG: should fail) - -// Copyright 2009 The Go Authors. All rights reserved. -// Use of this source code is governed by a BSD-style -// license that can be found in the LICENSE file. - -package main - -import "unsafe" - -var dummy [512<<20]byte // give us a big address space -func main() { - // the test only tests what we intend to test - // if dummy starts in the first 256 MB of memory. - // otherwise there might not be anything mapped - // at the address that might be accidentally - // dereferenced below. - if uintptr(unsafe.Pointer(&dummy)) > 256<<20 { - panic("dummy too far out") - } - - // The problem here is that indexing into p[] with a large - // enough index jumps out of the unmapped section - // at the beginning of memory and into valid memory. - // Pointer offsets and array indices, if they are - // very large, need to dereference the base pointer - // to trigger a trap. - var p *[1<<30]byte = nil - println(p[256<<20]) // very likely to be inside dummy, but should crash -} diff --git a/gcc/testsuite/go.test/test/nilptr/arraytoslice.go b/gcc/testsuite/go.test/test/nilptr/arraytoslice.go deleted file mode 100644 index 03879fb42f7..00000000000 --- a/gcc/testsuite/go.test/test/nilptr/arraytoslice.go +++ /dev/null @@ -1,36 +0,0 @@ -// $G $D/$F.go && $L $F.$A && -// ((! sh -c ./$A.out) >/dev/null 2>&1 || echo BUG: should fail) - -// Copyright 2009 The Go Authors. All rights reserved. -// Use of this source code is governed by a BSD-style -// license that can be found in the LICENSE file. - -package main - -import "unsafe" - -func f([]byte) { - panic("unreachable") -} - -var dummy [512<<20]byte // give us a big address space -func main() { - // the test only tests what we intend to test - // if dummy starts in the first 256 MB of memory. - // otherwise there might not be anything mapped - // at the address that might be accidentally - // dereferenced below. - if uintptr(unsafe.Pointer(&dummy)) > 256<<20 { - panic("dummy too far out") - } - - // The problem here is that indexing into p[] with a large - // enough index can jump out of the unmapped section - // at the beginning of memory and into valid memory. - // - // To avoid needing a check on every slice beyond the - // usual len and cap, we require the *array -> slice - // conversion to do the check. - var p *[1<<30]byte = nil - f(p[0:]) // should crash -} diff --git a/gcc/testsuite/go.test/test/nilptr/arraytoslice1.go b/gcc/testsuite/go.test/test/nilptr/arraytoslice1.go deleted file mode 100644 index c86070fa473..00000000000 --- a/gcc/testsuite/go.test/test/nilptr/arraytoslice1.go +++ /dev/null @@ -1,33 +0,0 @@ -// $G $D/$F.go && $L $F.$A && -// ((! sh -c ./$A.out) >/dev/null 2>&1 || echo BUG: should fail) - -// Copyright 2009 The Go Authors. All rights reserved. -// Use of this source code is governed by a BSD-style -// license that can be found in the LICENSE file. - -package main - -import "unsafe" - -var dummy [512<<20]byte // give us a big address space -func main() { - // the test only tests what we intend to test - // if dummy starts in the first 256 MB of memory. - // otherwise there might not be anything mapped - // at the address that might be accidentally - // dereferenced below. - if uintptr(unsafe.Pointer(&dummy)) > 256<<20 { - panic("dummy too far out") - } - - // The problem here is that indexing into p[] with a large - // enough index can jump out of the unmapped section - // at the beginning of memory and into valid memory. - // - // To avoid needing a check on every slice beyond the - // usual len and cap, we require the *array -> slice - // conversion to do the check. - var p *[1<<30]byte = nil - var x []byte = p[0:] // should crash - _ = x -} diff --git a/gcc/testsuite/go.test/test/nilptr/arraytoslice2.go b/gcc/testsuite/go.test/test/nilptr/arraytoslice2.go deleted file mode 100644 index 68ea44083cb..00000000000 --- a/gcc/testsuite/go.test/test/nilptr/arraytoslice2.go +++ /dev/null @@ -1,34 +0,0 @@ -// $G $D/$F.go && $L $F.$A && -// ((! sh -c ./$A.out) >/dev/null 2>&1 || echo BUG: should fail) - -// Copyright 2009 The Go Authors. All rights reserved. -// Use of this source code is governed by a BSD-style -// license that can be found in the LICENSE file. - -package main - -import "unsafe" - -var dummy [512<<20]byte // give us a big address space -var q *[1<<30]byte -func main() { - // the test only tests what we intend to test - // if dummy starts in the first 256 MB of memory. - // otherwise there might not be anything mapped - // at the address that might be accidentally - // dereferenced below. - if uintptr(unsafe.Pointer(&dummy)) > 256<<20 { - panic("dummy too far out") - } - - // The problem here is that indexing into p[] with a large - // enough index can jump out of the unmapped section - // at the beginning of memory and into valid memory. - // - // To avoid needing a check on every slice beyond the - // usual len and cap, we require the *array -> slice - // conversion to do the check. - var x []byte - var y = &x - *y = q[0:] // should crash (uses arraytoslice runtime routine) -} diff --git a/gcc/testsuite/go.test/test/nilptr/slicearray.go b/gcc/testsuite/go.test/test/nilptr/slicearray.go deleted file mode 100644 index 26ca4277328..00000000000 --- a/gcc/testsuite/go.test/test/nilptr/slicearray.go +++ /dev/null @@ -1,32 +0,0 @@ -// $G $D/$F.go && $L $F.$A && -// ((! sh -c ./$A.out) >/dev/null 2>&1 || echo BUG: should fail) - -// Copyright 2009 The Go Authors. All rights reserved. -// Use of this source code is governed by a BSD-style -// license that can be found in the LICENSE file. - -package main - -import "unsafe" - -var dummy [512<<20]byte // give us a big address space -func main() { - // the test only tests what we intend to test - // if dummy starts in the first 256 MB of memory. - // otherwise there might not be anything mapped - // at the address that might be accidentally - // dereferenced below. - if uintptr(unsafe.Pointer(&dummy)) > 256<<20 { - panic("dummy too far out") - } - - // The problem here is that indexing into p[] with a large - // enough index can jump out of the unmapped section - // at the beginning of memory and into valid memory. - // - // To avoid needing a check on every slice beyond the - // usual len and cap, we require the slice operation - // to do the check. - var p *[1<<30]byte = nil - var _ []byte = p[10:len(p)-10] // should crash -} diff --git a/gcc/testsuite/go.test/test/nilptr/structfield.go b/gcc/testsuite/go.test/test/nilptr/structfield.go deleted file mode 100644 index 35196bb68dd..00000000000 --- a/gcc/testsuite/go.test/test/nilptr/structfield.go +++ /dev/null @@ -1,34 +0,0 @@ -// $G $D/$F.go && $L $F.$A && -// ((! sh -c ./$A.out) >/dev/null 2>&1 || echo BUG: should fail) - -// Copyright 2009 The Go Authors. All rights reserved. -// Use of this source code is governed by a BSD-style -// license that can be found in the LICENSE file. - -package main - -import "unsafe" - -var dummy [512<<20]byte // give us a big address space -type T struct { - x [256<<20] byte - i int -} - -func main() { - // the test only tests what we intend to test - // if dummy starts in the first 256 MB of memory. - // otherwise there might not be anything mapped - // at the address that might be accidentally - // dereferenced below. - if uintptr(unsafe.Pointer(&dummy)) > 256<<20 { - panic("dummy too far out") - } - - // The problem here is that indexing into t with a large - // enough index can jump out of the unmapped section - // at the beginning of memory and into valid memory. - // We require the pointer dereference to check. - var t *T - println(t.i) // should crash -} diff --git a/gcc/testsuite/go.test/test/nilptr/structfield1.go b/gcc/testsuite/go.test/test/nilptr/structfield1.go deleted file mode 100644 index 7c7abed1aa0..00000000000 --- a/gcc/testsuite/go.test/test/nilptr/structfield1.go +++ /dev/null @@ -1,37 +0,0 @@ -// $G $D/$F.go && $L $F.$A && -// ((! sh -c ./$A.out) >/dev/null 2>&1 || echo BUG: should fail) - -// Copyright 2009 The Go Authors. All rights reserved. -// Use of this source code is governed by a BSD-style -// license that can be found in the LICENSE file. - -package main - -import "unsafe" - -var dummy [512<<20]byte // give us a big address space -type T struct { - x [256<<20] byte - i int -} - -func f() *T { - return nil -} - -func main() { - // the test only tests what we intend to test - // if dummy starts in the first 256 MB of memory. - // otherwise there might not be anything mapped - // at the address that might be accidentally - // dereferenced below. - if uintptr(unsafe.Pointer(&dummy)) > 256<<20 { - panic("dummy too far out") - } - - // The problem here is that indexing into t with a large - // enough index can jump out of the unmapped section - // at the beginning of memory and into valid memory. - // We require the pointer dereference to check. - println(f().i) // should crash -} diff --git a/gcc/testsuite/go.test/test/nilptr/structfield2.go b/gcc/testsuite/go.test/test/nilptr/structfield2.go deleted file mode 100644 index 02a44f17318..00000000000 --- a/gcc/testsuite/go.test/test/nilptr/structfield2.go +++ /dev/null @@ -1,36 +0,0 @@ -// $G $D/$F.go && $L $F.$A && -// ((! sh -c ./$A.out) >/dev/null 2>&1 || echo BUG: should fail) - -// Copyright 2009 The Go Authors. All rights reserved. -// Use of this source code is governed by a BSD-style -// license that can be found in the LICENSE file. - -package main - -import "unsafe" - -var dummy [512<<20]byte // give us a big address space -type T struct { - x [256<<20] byte - i int -} - -var y *T -var x = &y - -func main() { - // the test only tests what we intend to test - // if dummy starts in the first 256 MB of memory. - // otherwise there might not be anything mapped - // at the address that might be accidentally - // dereferenced below. - if uintptr(unsafe.Pointer(&dummy)) > 256<<20 { - panic("dummy too far out") - } - - // The problem here is that indexing into t with a large - // enough index can jump out of the unmapped section - // at the beginning of memory and into valid memory. - // We require the pointer dereference to check. - println((*x).i) // should crash -} diff --git a/gcc/testsuite/go.test/test/nilptr/structfieldaddr.go b/gcc/testsuite/go.test/test/nilptr/structfieldaddr.go deleted file mode 100644 index f3177bafbaa..00000000000 --- a/gcc/testsuite/go.test/test/nilptr/structfieldaddr.go +++ /dev/null @@ -1,34 +0,0 @@ -// $G $D/$F.go && $L $F.$A && -// ((! sh -c ./$A.out) >/dev/null 2>&1 || echo BUG: should fail) - -// Copyright 2009 The Go Authors. All rights reserved. -// Use of this source code is governed by a BSD-style -// license that can be found in the LICENSE file. - -package main - -import "unsafe" - -var dummy [512<<20]byte // give us a big address space -type T struct { - x [256<<20] byte - i int -} - -func main() { - // the test only tests what we intend to test - // if dummy starts in the first 256 MB of memory. - // otherwise there might not be anything mapped - // at the address that might be accidentally - // dereferenced below. - if uintptr(unsafe.Pointer(&dummy)) > 256<<20 { - panic("dummy too far out") - } - - // The problem here is that indexing into t with a large - // enough index can jump out of the unmapped section - // at the beginning of memory and into valid memory. - // We require the address calculation to check. - var t *T - println(&t.i) // should crash -} diff --git a/gcc/testsuite/go.test/test/peano.go b/gcc/testsuite/go.test/test/peano.go index f4c59d1e1a2..dd4c36e0b43 100644 --- a/gcc/testsuite/go.test/test/peano.go +++ b/gcc/testsuite/go.test/test/peano.go @@ -8,7 +8,6 @@ package main type Number *Number - // ------------------------------------- // Peano primitives @@ -16,24 +15,20 @@ func zero() *Number { return nil } - func is_zero(x *Number) bool { return x == nil } - func add1(x *Number) *Number { e := new(Number) *e = x return e } - func sub1(x *Number) *Number { return *x } - func add(x, y *Number) *Number { if is_zero(y) { return x @@ -42,7 +37,6 @@ func add(x, y *Number) *Number { return add(add1(x), sub1(y)) } - func mul(x, y *Number) *Number { if is_zero(x) || is_zero(y) { return zero() @@ -51,7 +45,6 @@ func mul(x, y *Number) *Number { return add(mul(x, sub1(y)), x) } - func fact(n *Number) *Number { if is_zero(n) { return add1(zero()) @@ -60,7 +53,6 @@ func fact(n *Number) *Number { return mul(fact(sub1(n)), n) } - // ------------------------------------- // Helpers to generate/count Peano integers @@ -72,7 +64,6 @@ func gen(n int) *Number { return zero() } - func count(x *Number) int { if is_zero(x) { return 0 @@ -81,7 +72,6 @@ func count(x *Number) int { return count(sub1(x)) + 1 } - func check(x *Number, expected int) { var c = count(x) if c != expected { @@ -90,7 +80,6 @@ func check(x *Number, expected int) { } } - // ------------------------------------- // Test basic functionality @@ -115,12 +104,19 @@ func init() { check(fact(gen(5)), 120) } - // ------------------------------------- // Factorial +var results = [...]int{ + 1, 1, 2, 6, 24, 120, 720, 5040, 40320, 362880, 3628800, + 39916800, 479001600, +} + func main() { for i := 0; i <= 9; i++ { - print(i, "! = ", count(fact(gen(i))), "\n") + if f := count(fact(gen(i))); f != results[i] { + println("FAIL:", i, "!:", f, "!=", results[i]) + panic(0) + } } } diff --git a/gcc/testsuite/go.test/test/printbig.go b/gcc/testsuite/go.test/test/printbig.go index bbb707004ff..d867bdc646c 100644 --- a/gcc/testsuite/go.test/test/printbig.go +++ b/gcc/testsuite/go.test/test/printbig.go @@ -1,4 +1,4 @@ -// $G $F.go && $L $F.$A && ./$A.out +// $G $F.go && $L $F.$A && ./$A.out 2>&1 | cmp - $D/$F.out // Copyright 2009 The Go Authors. All rights reserved. // Use of this source code is governed by a BSD-style diff --git a/gcc/testsuite/go.test/test/printbig.out b/gcc/testsuite/go.test/test/printbig.out new file mode 100644 index 00000000000..6a16b15d987 --- /dev/null +++ b/gcc/testsuite/go.test/test/printbig.out @@ -0,0 +1,2 @@ +-9223372036854775808 +9223372036854775807 diff --git a/gcc/testsuite/go.test/test/reorder.go b/gcc/testsuite/go.test/test/reorder.go new file mode 100644 index 00000000000..67d07523b41 --- /dev/null +++ b/gcc/testsuite/go.test/test/reorder.go @@ -0,0 +1,121 @@ +// $G $D/$F.go && $L $F.$A && ./$A.out + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// Check reordering of assignments. + +package main + +import "fmt" + +func main() { + p1() + p2() + p3() + p4() + p5() + p6() + p7() + p8() +} + +var gx []int + +func f(i int) int { + return gx[i] +} + +func check(x []int, x0, x1, x2 int) { + if x[0] != x0 || x[1] != x1 || x[2] != x2 { + fmt.Printf("%v, want %d,%d,%d\n", x, x0, x1, x2) + panic("failed") + } +} + +func check3(x, y, z, xx, yy, zz int) { + if x != xx || y != yy || z != zz { + fmt.Printf("%d,%d,%d, want %d,%d,%d\n", x, y, z, xx, yy, zz) + panic("failed") + } +} + +func p1() { + x := []int{1,2,3} + i := 0 + i, x[i] = 1, 100 + _ = i + check(x, 100, 2, 3) +} + +func p2() { + x := []int{1,2,3} + i := 0 + x[i], i = 100, 1 + _ = i + check(x, 100, 2, 3) +} + +func p3() { + x := []int{1,2,3} + y := x + gx = x + x[1], y[0] = f(0), f(1) + check(x, 2, 1, 3) +} + +func p4() { + x := []int{1,2,3} + y := x + gx = x + x[1], y[0] = gx[0], gx[1] + check(x, 2, 1, 3) +} + +func p5() { + x := []int{1,2,3} + y := x + p := &x[0] + q := &x[1] + *p, *q = x[1], y[0] + check(x, 2, 1, 3) +} + +func p6() { + x := 1 + y := 2 + z := 3 + px := &x + py := &y + *px, *py = y, x + check3(x, y, z, 2, 1, 3) +} + +func f1(x, y, z int) (xx, yy, zz int) { + return x, y, z +} + +func f2() (x, y, z int) { + return f1(2, 1, 3) +} + +func p7() { + x, y, z := f2() + check3(x, y, z, 2, 1, 3) +} + +func p8() { + x := []int{1,2,3} + + defer func() { + err := recover() + if err == nil { + panic("not panicking") + } + check(x, 100, 2, 3) + }() + + i := 0 + i, x[i], x[5] = 1, 100, 500 +} diff --git a/gcc/testsuite/go.test/test/run b/gcc/testsuite/go.test/test/run index bc31d2f7140..03c91ee30ee 100755 --- a/gcc/testsuite/go.test/test/run +++ b/gcc/testsuite/go.test/test/run @@ -23,7 +23,7 @@ Xarm) exit 1 esac -export G=${A}g +export G="${A}g ${GCFLAGS}" export L=${A}l export GOTRACEBACK=0 export LANG=C @@ -31,7 +31,7 @@ unset GREP_OPTIONS # in case user has a non-standard set failed=0 -PATH=/bin:/usr/bin:/usr/local/bin:${GOBIN:-$GOROOT/bin}:`pwd` +PATH=${GOBIN:-$GOROOT/bin}:`pwd`:/bin:/usr/bin:/usr/local/bin RUNFILE="/tmp/gorun-$$-$USER" TMP1FILE="/tmp/gotest1-$$-$USER" @@ -53,7 +53,7 @@ filterout() { grep '^'"$2"'$' $1 >/dev/null } -for dir in . ken chan interface nilptr syntax fixedbugs bugs +for dir in . ken chan interface syntax dwarf fixedbugs bugs do echo echo '==' $dir'/' diff --git a/gcc/testsuite/go.test/test/rune.go b/gcc/testsuite/go.test/test/rune.go new file mode 100644 index 00000000000..3386972b6d7 --- /dev/null +++ b/gcc/testsuite/go.test/test/rune.go @@ -0,0 +1,44 @@ +// $G $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package main + +var ( + r0 = 'a' + r1 = 'a'+1 + r2 = 1+'a' + r3 = 'a'*2 + r4 = 'a'/2 + r5 = 'a'<<1 + r6 = 'b'<<2 + r7 int32 + + r = []rune{r0, r1, r2, r3, r4, r5, r6, r7} +) + +var ( + f0 = 1.2 + f1 = 1.2/'a' + + f = []float64{f0, f1} +) + +var ( + i0 = 1 + i1 = 1<<'\x01' + + i = []int{i0, i1} +) + +const ( + maxRune = '\U0010FFFF' +) + +var ( + b0 = maxRune < r0 + + b = []bool{b0} +) diff --git a/gcc/testsuite/go.test/test/sigchld.go b/gcc/testsuite/go.test/test/sigchld.go index 1fb2e21bd56..e7c3d5abb48 100644 --- a/gcc/testsuite/go.test/test/sigchld.go +++ b/gcc/testsuite/go.test/test/sigchld.go @@ -1,4 +1,5 @@ -// $G $D/$F.go && $L $F.$A && ./$A.out +// [ "$GOOS" == windows ] || +// ($G $D/$F.go && $L $F.$A && ./$A.out 2>&1 | cmp - $D/$F.out) // Copyright 2009 The Go Authors. All rights reserved. // Use of this source code is governed by a BSD-style diff --git a/gcc/testsuite/go.test/test/sigchld.out b/gcc/testsuite/go.test/test/sigchld.out new file mode 100644 index 00000000000..477d0257967 --- /dev/null +++ b/gcc/testsuite/go.test/test/sigchld.out @@ -0,0 +1 @@ +survived SIGCHLD diff --git a/gcc/testsuite/go.test/test/sinit.go b/gcc/testsuite/go.test/test/sinit.go index 2adb931e141..5cd3a4567b8 100644 --- a/gcc/testsuite/go.test/test/sinit.go +++ b/gcc/testsuite/go.test/test/sinit.go @@ -1,4 +1,4 @@ -// $G -S $D/$F.go | egrep initdone >/dev/null && echo FAIL || true +// $G -S $D/$F.go | egrep initdone >/dev/null && echo BUG sinit || true // Copyright 2010 The Go Authors. All rights reserved. // Use of this source code is governed by a BSD-style @@ -9,45 +9,45 @@ package p // Should be no init func in the assembly. // All these initializations should be done at link time. -type S struct{ a,b,c int } -type SS struct{ aa,bb,cc S } -type SA struct{ a,b,c [3]int } -type SC struct{ a,b,c []int } +type S struct{ a, b, c int } +type SS struct{ aa, bb, cc S } +type SA struct{ a, b, c [3]int } +type SC struct{ a, b, c []int } var ( - zero = 2 - one = 1 - pi = 3.14 - slice = []byte{1,2,3} - sliceInt = []int{1,2,3} - hello = "hello, world" - bytes = []byte("hello, world") - four, five = 4, 5 - x, y = 0.1, "hello" - nilslice []byte = nil - nilmap map[string]int = nil - nilfunc func() = nil - nilchan chan int = nil - nilptr *byte = nil + zero = 2 + one = 1 + pi = 3.14 + slice = []byte{1, 2, 3} + sliceInt = []int{1, 2, 3} + hello = "hello, world" + bytes = []byte("hello, world") + four, five = 4, 5 + x, y = 0.1, "hello" + nilslice []byte = nil + nilmap map[string]int = nil + nilfunc func() = nil + nilchan chan int = nil + nilptr *byte = nil ) -var a = [3]int{1001, 1002, 1003} -var s = S{1101, 1102, 1103} -var c = []int{1201, 1202, 1203} +var a = [3]int{1001, 1002, 1003} +var s = S{1101, 1102, 1103} +var c = []int{1201, 1202, 1203} -var aa = [3][3]int{[3]int{2001,2002,2003}, [3]int{2004,2005,2006}, [3]int{2007,2008,2009}} -var as = [3]S{S{2101,2102,2103},S{2104,2105,2106},S{2107,2108,2109}} -var ac = [3][]int{[]int{2201,2202,2203}, []int{2204,2205,2206}, []int{2207,2208,2209}} +var aa = [3][3]int{[3]int{2001, 2002, 2003}, [3]int{2004, 2005, 2006}, [3]int{2007, 2008, 2009}} +var as = [3]S{S{2101, 2102, 2103}, S{2104, 2105, 2106}, S{2107, 2108, 2109}} +var ac = [3][]int{[]int{2201, 2202, 2203}, []int{2204, 2205, 2206}, []int{2207, 2208, 2209}} -var sa = SA{[3]int{3001,3002,3003},[3]int{3004,3005,3006},[3]int{3007,3008,3009}} -var ss = SS{S{3101,3102,3103},S{3104,3105,3106},S{3107,3108,3109}} -var sc = SC{[]int{3201,3202,3203},[]int{3204,3205,3206},[]int{3207,3208,3209}} +var sa = SA{[3]int{3001, 3002, 3003}, [3]int{3004, 3005, 3006}, [3]int{3007, 3008, 3009}} +var ss = SS{S{3101, 3102, 3103}, S{3104, 3105, 3106}, S{3107, 3108, 3109}} +var sc = SC{[]int{3201, 3202, 3203}, []int{3204, 3205, 3206}, []int{3207, 3208, 3209}} -var ca = [][3]int{[3]int{4001,4002,4003}, [3]int{4004,4005,4006}, [3]int{4007,4008,4009}} -var cs = []S{S{4101,4102,4103},S{4104,4105,4106},S{4107,4108,4109}} -var cc = [][]int{[]int{4201,4202,4203}, []int{4204,4205,4206}, []int{4207,4208,4209}} +var ca = [][3]int{[3]int{4001, 4002, 4003}, [3]int{4004, 4005, 4006}, [3]int{4007, 4008, 4009}} +var cs = []S{S{4101, 4102, 4103}, S{4104, 4105, 4106}, S{4107, 4108, 4109}} +var cc = [][]int{[]int{4201, 4202, 4203}, []int{4204, 4205, 4206}, []int{4207, 4208, 4209}} -var answers = [...]int { +var answers = [...]int{ // s 1101, 1102, 1103, @@ -98,3 +98,158 @@ var answers = [...]int { 2008, 2208, 2308, 4008, 4208, 4308, 5008, 5208, 5308, 2009, 2209, 2309, 4009, 4209, 4309, 5009, 5209, 5309, } + +var ( + copy_zero = zero + copy_one = one + copy_pi = pi + copy_slice = slice + copy_sliceInt = sliceInt + copy_hello = hello + copy_bytes = bytes + copy_four, copy_five = four, five + copy_x, copy_y = x, y + copy_nilslice = nilslice + copy_nilmap = nilmap + copy_nilfunc = nilfunc + copy_nilchan = nilchan + copy_nilptr = nilptr +) + +var copy_a = a +var copy_s = s +var copy_c = c + +var copy_aa = aa +var copy_as = as +var copy_ac = ac + +var copy_sa = sa +var copy_ss = ss +var copy_sc = sc + +var copy_ca = ca +var copy_cs = cs +var copy_cc = cc + +var copy_answers = answers + +var bx bool +var b0 = false +var b1 = true + +var fx float32 +var f0 = float32(0) +var f1 = float32(1) + +var gx float64 +var g0 = float64(0) +var g1 = float64(1) + +var ix int +var i0 = 0 +var i1 = 1 + +var jx uint +var j0 = uint(0) +var j1 = uint(1) + +var cx complex64 +var c0 = complex64(0) +var c1 = complex64(1) + +var dx complex128 +var d0 = complex128(0) +var d1 = complex128(1) + +var sx []int +var s0 = []int{0, 0, 0} +var s1 = []int{1, 2, 3} + +func fi() int + +var ax [10]int +var a0 = [10]int{0, 0, 0} +var a1 = [10]int{1, 2, 3, 4} + +type T struct{ X, Y int } + +var tx T +var t0 = T{} +var t0a = T{0, 0} +var t0b = T{X: 0} +var t1 = T{X: 1, Y: 2} +var t1a = T{3, 4} + +var psx *[]int +var ps0 = &[]int{0, 0, 0} +var ps1 = &[]int{1, 2, 3} + +var pax *[10]int +var pa0 = &[10]int{0, 0, 0} +var pa1 = &[10]int{1, 2, 3} + +var ptx *T +var pt0 = &T{} +var pt0a = &T{0, 0} +var pt0b = &T{X: 0} +var pt1 = &T{X: 1, Y: 2} +var pt1a = &T{3, 4} + +var copy_bx = bx +var copy_b0 = b0 +var copy_b1 = b1 + +var copy_fx = fx +var copy_f0 = f0 +var copy_f1 = f1 + +var copy_gx = gx +var copy_g0 = g0 +var copy_g1 = g1 + +var copy_ix = ix +var copy_i0 = i0 +var copy_i1 = i1 + +var copy_jx = jx +var copy_j0 = j0 +var copy_j1 = j1 + +var copy_cx = cx +var copy_c0 = c0 +var copy_c1 = c1 + +var copy_dx = dx +var copy_d0 = d0 +var copy_d1 = d1 + +var copy_sx = sx +var copy_s0 = s0 +var copy_s1 = s1 + +var copy_ax = ax +var copy_a0 = a0 +var copy_a1 = a1 + +var copy_tx = tx +var copy_t0 = t0 +var copy_t0a = t0a +var copy_t0b = t0b +var copy_t1 = t1 +var copy_t1a = t1a + +var copy_psx = psx +var copy_ps0 = ps0 +var copy_ps1 = ps1 + +var copy_pax = pax +var copy_pa0 = pa0 +var copy_pa1 = pa1 + +var copy_ptx = ptx +var copy_pt0 = pt0 +var copy_pt0a = pt0a +var copy_pt0b = pt0b +var copy_pt1 = pt1 +var copy_pt1a = pt1a diff --git a/gcc/testsuite/go.test/test/struct0.go b/gcc/testsuite/go.test/test/struct0.go new file mode 100644 index 00000000000..2398c4117d3 --- /dev/null +++ b/gcc/testsuite/go.test/test/struct0.go @@ -0,0 +1,34 @@ +// $G $D/$F.go && $L $F.$A && ./$A.out + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +// zero length structs. +// used to not be evaluated. +// issue 2232. + +package main + +func recv(c chan interface{}) struct{} { + return (<-c).(struct{}) +} + +var m = make(map[interface{}]int) + +func recv1(c chan interface{}) { + defer rec() + m[(<-c).(struct{})] = 0 +} + +func rec() { + recover() +} + +func main() { + c := make(chan interface{}) + go recv(c) + c <- struct{}{} + go recv1(c) + c <- struct{}{} +} diff --git a/gcc/testsuite/go.test/test/switch.go b/gcc/testsuite/go.test/test/switch.go index 0c253d6e2a7..bed027ce85f 100644 --- a/gcc/testsuite/go.test/test/switch.go +++ b/gcc/testsuite/go.test/test/switch.go @@ -19,48 +19,75 @@ func main() { hello := "hello" switch true { - case i5 < 5: assert(false, "<") - case i5 == 5: assert(true, "!") - case i5 > 5: assert(false, ">") + case i5 < 5: + assert(false, "<") + case i5 == 5: + assert(true, "!") + case i5 > 5: + assert(false, ">") } switch { - case i5 < 5: assert(false, "<") - case i5 == 5: assert(true, "!") - case i5 > 5: assert(false, ">") + case i5 < 5: + assert(false, "<") + case i5 == 5: + assert(true, "!") + case i5 > 5: + assert(false, ">") } switch x := 5; true { - case i5 < x: assert(false, "<") - case i5 == x: assert(true, "!") - case i5 > x: assert(false, ">") + case i5 < x: + assert(false, "<") + case i5 == x: + assert(true, "!") + case i5 > x: + assert(false, ">") } switch x := 5; true { - case i5 < x: assert(false, "<") - case i5 == x: assert(true, "!") - case i5 > x: assert(false, ">") + case i5 < x: + assert(false, "<") + case i5 == x: + assert(true, "!") + case i5 > x: + assert(false, ">") } switch i5 { - case 0: assert(false, "0") - case 1: assert(false, "1") - case 2: assert(false, "2") - case 3: assert(false, "3") - case 4: assert(false, "4") - case 5: assert(true, "5") - case 6: assert(false, "6") - case 7: assert(false, "7") - case 8: assert(false, "8") - case 9: assert(false, "9") - default: assert(false, "default") + case 0: + assert(false, "0") + case 1: + assert(false, "1") + case 2: + assert(false, "2") + case 3: + assert(false, "3") + case 4: + assert(false, "4") + case 5: + assert(true, "5") + case 6: + assert(false, "6") + case 7: + assert(false, "7") + case 8: + assert(false, "8") + case 9: + assert(false, "9") + default: + assert(false, "default") } switch i5 { - case 0,1,2,3,4: assert(false, "4") - case 5: assert(true, "5") - case 6,7,8,9: assert(false, "9") - default: assert(false, "default") + case 0, 1, 2, 3, 4: + assert(false, "4") + case 5: + assert(true, "5") + case 6, 7, 8, 9: + assert(false, "9") + default: + assert(false, "default") } switch i5 { @@ -68,72 +95,188 @@ func main() { case 1: case 2: case 3: - case 4: assert(false, "4") - case 5: assert(true, "5") + case 4: + assert(false, "4") + case 5: + assert(true, "5") case 6: case 7: case 8: case 9: - default: assert(i5 == 5, "good") + default: + assert(i5 == 5, "good") } switch i5 { - case 0: dummy := 0; _ = dummy; fallthrough - case 1: dummy := 0; _ = dummy; fallthrough - case 2: dummy := 0; _ = dummy; fallthrough - case 3: dummy := 0; _ = dummy; fallthrough - case 4: dummy := 0; _ = dummy; assert(false, "4") - case 5: dummy := 0; _ = dummy; fallthrough - case 6: dummy := 0; _ = dummy; fallthrough - case 7: dummy := 0; _ = dummy; fallthrough - case 8: dummy := 0; _ = dummy; fallthrough - case 9: dummy := 0; _ = dummy; fallthrough - default: dummy := 0; _ = dummy; assert(i5 == 5, "good") + case 0: + dummy := 0 + _ = dummy + fallthrough + case 1: + dummy := 0 + _ = dummy + fallthrough + case 2: + dummy := 0 + _ = dummy + fallthrough + case 3: + dummy := 0 + _ = dummy + fallthrough + case 4: + dummy := 0 + _ = dummy + assert(false, "4") + case 5: + dummy := 0 + _ = dummy + fallthrough + case 6: + dummy := 0 + _ = dummy + fallthrough + case 7: + dummy := 0 + _ = dummy + fallthrough + case 8: + dummy := 0 + _ = dummy + fallthrough + case 9: + dummy := 0 + _ = dummy + fallthrough + default: + dummy := 0 + _ = dummy + assert(i5 == 5, "good") } fired := false switch i5 { - case 0: dummy := 0; _ = dummy; fallthrough; // tests scoping of cases - case 1: dummy := 0; _ = dummy; fallthrough - case 2: dummy := 0; _ = dummy; fallthrough - case 3: dummy := 0; _ = dummy; fallthrough - case 4: dummy := 0; _ = dummy; assert(false, "4") - case 5: dummy := 0; _ = dummy; fallthrough - case 6: dummy := 0; _ = dummy; fallthrough - case 7: dummy := 0; _ = dummy; fallthrough - case 8: dummy := 0; _ = dummy; fallthrough - case 9: dummy := 0; _ = dummy; fallthrough - default: dummy := 0; _ = dummy; fired = !fired; assert(i5 == 5, "good") + case 0: + dummy := 0 + _ = dummy + fallthrough // tests scoping of cases + case 1: + dummy := 0 + _ = dummy + fallthrough + case 2: + dummy := 0 + _ = dummy + fallthrough + case 3: + dummy := 0 + _ = dummy + fallthrough + case 4: + dummy := 0 + _ = dummy + assert(false, "4") + case 5: + dummy := 0 + _ = dummy + fallthrough + case 6: + dummy := 0 + _ = dummy + fallthrough + case 7: + dummy := 0 + _ = dummy + fallthrough + case 8: + dummy := 0 + _ = dummy + fallthrough + case 9: + dummy := 0 + _ = dummy + fallthrough + default: + dummy := 0 + _ = dummy + fired = !fired + assert(i5 == 5, "good") } assert(fired, "fired") count := 0 switch i5 { - case 0: count = count + 1; fallthrough - case 1: count = count + 1; fallthrough - case 2: count = count + 1; fallthrough - case 3: count = count + 1; fallthrough - case 4: count = count + 1; assert(false, "4") - case 5: count = count + 1; fallthrough - case 6: count = count + 1; fallthrough - case 7: count = count + 1; fallthrough - case 8: count = count + 1; fallthrough - case 9: count = count + 1; fallthrough - default: assert(i5 == count, "good") + case 0: + count = count + 1 + fallthrough + case 1: + count = count + 1 + fallthrough + case 2: + count = count + 1 + fallthrough + case 3: + count = count + 1 + fallthrough + case 4: + count = count + 1 + assert(false, "4") + case 5: + count = count + 1 + fallthrough + case 6: + count = count + 1 + fallthrough + case 7: + count = count + 1 + fallthrough + case 8: + count = count + 1 + fallthrough + case 9: + count = count + 1 + fallthrough + default: + assert(i5 == count, "good") } assert(fired, "fired") switch hello { - case "wowie": assert(false, "wowie") - case "hello": assert(true, "hello") - case "jumpn": assert(false, "jumpn") - default: assert(false, "default") + case "wowie": + assert(false, "wowie") + case "hello": + assert(true, "hello") + case "jumpn": + assert(false, "jumpn") + default: + assert(false, "default") } fired = false switch i := i5 + 2; i { - case i7: fired = true - default: assert(false, "fail") + case i7: + fired = true + default: + assert(false, "fail") } assert(fired, "var") + + // switch on nil-only comparison types + switch f := func() {}; f { + case nil: + assert(false, "f should not be nil") + default: + } + + switch m := make(map[int]int); m { + case nil: + assert(false, "m should not be nil") + default: + } + + switch a := make([]int, 1); a { + case nil: + assert(false, "m should not be nil") + default: + } } diff --git a/gcc/testsuite/go.test/test/switch3.go b/gcc/testsuite/go.test/test/switch3.go new file mode 100644 index 00000000000..6c9ebfe6d48 --- /dev/null +++ b/gcc/testsuite/go.test/test/switch3.go @@ -0,0 +1,58 @@ +// errchk $G -e $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package main + +type I interface { + M() +} + +func bad() { + var i I + var s string + + switch i { + case s: // ERROR "mismatched types string and I|incompatible types" + } + + switch s { + case i: // ERROR "mismatched types I and string|incompatible types" + } + + var m, m1 map[int]int + switch m { + case nil: + case m1: // ERROR "can only compare map m to nil|map can only be compared to nil" + default: + } + + var a, a1 []int + switch a { + case nil: + case a1: // ERROR "can only compare slice a to nil|slice can only be compared to nil" + default: + } + + var f, f1 func() + switch f { + case nil: + case f1: // ERROR "can only compare func f to nil|func can only be compared to nil" + default: + } +} + +func good() { + var i interface{} + var s string + + switch i { + case s: + } + + switch s { + case i: + } +} diff --git a/gcc/testsuite/go.test/test/syntax/else.go b/gcc/testsuite/go.test/test/syntax/else.go new file mode 100644 index 00000000000..99595254fd4 --- /dev/null +++ b/gcc/testsuite/go.test/test/syntax/else.go @@ -0,0 +1,12 @@ +// errchk $G $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package main + +func main() { + if true { + } else ; // ERROR "else must be followed by if or statement block|expected .if. or .{." +} diff --git a/gcc/testsuite/go.test/test/times.out b/gcc/testsuite/go.test/test/times.out new file mode 100644 index 00000000000..841fab9ef2b --- /dev/null +++ b/gcc/testsuite/go.test/test/times.out @@ -0,0 +1,632 @@ +0.04 ./235 +1.72 ./64bit +0.03 ./alias +0.03 ./alias1 +0.30 ./append +0.07 ./args +0.02 ./assign +0.04 ./assign1 +0.04 ./bigalg +0.03 ./bigmap +0.14 ./blank +0.03 ./blank1 +0.03 ./chancap +0.07 ./char_lit +0.03 ./char_lit1 +0.09 ./closedchan +0.05 ./closure +0.06 ./cmp +0.02 ./cmp6 +0.03 ./cmplx +0.60 ./cmplxdivide +0.00 ./cmplxdivide1 +0.04 ./complit +0.02 ./complit1 +0.03 ./compos +0.04 ./const +0.03 ./const1 +0.03 ./const2 +0.13 ./const3 +0.08 ./convert +0.03 ./convert1 +0.02 ./convert3 +0.04 ./convlit +0.02 ./convlit1 +0.34 ./copy +0.27 ./crlf +0.05 ./ddd +0.02 ./ddd1 +0.00 ./ddd2 +0.04 ./ddd3 +0.03 ./decl +0.03 ./declbad +0.14 ./defer +0.03 ./deferprint +0.14 ./divide +0.00 ./empty +0.08 ./env +0.00 ./eof +0.00 ./eof1 +0.04 ./escape +0.12 ./escape2 +0.03 ./escape3 +0.05 ./float_lit +0.14 ./floatcmp +0.03 ./for +0.04 ./func +0.03 ./func1 +0.00 ./func2 +0.03 ./func3 +0.03 ./func4 +0.03 ./func5 +0.00 ./func6 +0.04 ./func7 +0.03 ./gc +0.04 ./gc1 +0.26 ./gc2 +0.06 ./goprint +0.04 ./goto +0.04 ./hashmap +0.03 ./helloworld +0.03 ./if +0.02 ./import +0.15 ./import1 +0.00 ./import2 +0.01 ./import3 +0.14 ./import4 +1.70 ./index +0.03 ./indirect +0.02 ./indirect1 +0.02 ./init +0.25 ./init1 +0.03 ./initcomma +0.15 ./initialize +0.02 ./initializerr +0.06 ./initsyscall +0.07 ./int_lit +0.03 ./intcvt +0.03 ./iota +0.03 ./label +0.03 ./label1 +0.04 ./literal +0.15 ./malloc1 +0.06 ./mallocfin +0.19 ./mallocrand +0.21 ./mallocrep +0.52 ./mallocrep1 +0.17 ./map +0.02 ./map1 +0.05 ./method +0.02 ./method1 +0.03 ./method2 +0.04 ./method3 +0.06 ./named +0.03 ./named1 +0.18 ./nil +0.15 ./nilptr +0.16 ./nul1 +0.00 ./parentype +0.11 ./peano +0.02 ./printbig +0.05 ./range +0.04 ./recover +0.04 ./recover1 +0.08 ./recover2 +0.06 ./recover3 +0.14 ./rename +0.02 ./rename1 +0.16 ./reorder +0.00 ./rune +0.03 ./runtime +0.03 ./shift1 +0.01 ./shift2 +0.03 ./sieve +0.06 ./sigchld +0.03 ./simassign +0.02 ./sinit +0.00 ./sizeof +0.03 ./solitaire +0.06 ./stack +0.08 ./string_lit +0.14 ./stringrange +0.04 ./struct0 +0.04 ./switch +0.08 ./switch1 +0.02 ./switch3 +0.04 ./test0 +0.03 ./turing +0.07 ./typeswitch +0.15 ./typeswitch1 +0.02 ./typeswitch2 +0.03 ./typeswitch3 +0.02 ./undef +0.04 ./utf +0.03 ./varerr +0.03 ./varinit +0.26 ./zerodivide +0.04 ken/array +0.11 ken/chan +0.04 ken/chan1 +0.04 ken/complit +0.07 ken/convert +0.03 ken/cplx0 +0.02 ken/cplx1 +0.06 ken/cplx2 +0.09 ken/cplx3 +0.14 ken/cplx4 +0.03 ken/cplx5 +0.31 ken/divconst +0.05 ken/divmod +0.04 ken/embed +0.03 ken/for +0.04 ken/interbasic +0.03 ken/interfun +0.04 ken/intervar +0.03 ken/label +0.03 ken/litfun +0.03 ken/mfunc +0.34 ken/modconst +0.03 ken/ptrfun +0.03 ken/ptrvar +0.04 ken/range +0.03 ken/rob1 +0.18 ken/rob2 +0.04 ken/robfor +0.04 ken/robfunc +0.03 ken/shift +0.03 ken/simparray +0.04 ken/simpbool +0.03 ken/simpconv +0.03 ken/simpfun +0.03 ken/simpswitch +0.03 ken/simpvar +0.02 ken/slicearray +0.03 ken/sliceslice +0.03 ken/string +0.03 ken/strvar +0.32 chan/doubleselect +0.06 chan/fifo +0.12 chan/goroutines +0.07 chan/nonblock +0.02 chan/perm +0.10 chan/powser1 +0.09 chan/powser2 +0.03 chan/select +0.15 chan/select2 +0.97 chan/select3 +0.03 chan/select4 +0.72 chan/select5 +0.03 chan/select6 +0.04 chan/select7 +0.03 chan/sendstmt +0.03 chan/sieve1 +0.04 chan/sieve2 +0.02 chan/zerosize +0.04 interface/bigdata +0.04 interface/convert +0.03 interface/convert1 +0.03 interface/convert2 +0.09 interface/embed +0.00 interface/embed0 +0.03 interface/embed1 +0.02 interface/embed2 +0.02 interface/explicit +0.03 interface/fail +0.09 interface/fake +0.03 interface/noeq +0.03 interface/pointer +0.03 interface/private +0.00 interface/private1 +0.04 interface/receiver +0.03 interface/receiver1 +0.00 interface/recursive +0.03 interface/returntype +0.09 interface/struct +0.02 syntax/chan +0.03 syntax/chan1 +0.02 syntax/else +0.02 syntax/forvar +0.03 syntax/if +0.03 syntax/import +0.03 syntax/interface +0.03 syntax/semi1 +0.02 syntax/semi2 +0.03 syntax/semi3 +0.03 syntax/semi4 +0.02 syntax/semi5 +0.03 syntax/semi6 +0.02 syntax/semi7 +0.02 syntax/topexpr +0.03 syntax/typesw +0.02 syntax/vareq +0.03 syntax/vareq1 +0.04 dwarf/linedirectives +0.05 dwarf/main +0.00 dwarf/z1 +0.00 dwarf/z10 +0.00 dwarf/z11 +0.00 dwarf/z12 +0.00 dwarf/z13 +0.00 dwarf/z14 +0.00 dwarf/z15 +0.00 dwarf/z16 +0.00 dwarf/z17 +0.00 dwarf/z18 +0.00 dwarf/z19 +0.00 dwarf/z2 +0.00 dwarf/z20 +0.00 dwarf/z3 +0.00 dwarf/z4 +0.00 dwarf/z5 +0.00 dwarf/z6 +0.00 dwarf/z7 +0.00 dwarf/z8 +0.00 dwarf/z9 +0.03 fixedbugs/bug000 +0.03 fixedbugs/bug002 +0.03 fixedbugs/bug003 +0.03 fixedbugs/bug004 +0.04 fixedbugs/bug005 +0.08 fixedbugs/bug006 +0.03 fixedbugs/bug007 +0.03 fixedbugs/bug008 +0.02 fixedbugs/bug009 +0.03 fixedbugs/bug010 +0.03 fixedbugs/bug011 +0.03 fixedbugs/bug012 +0.03 fixedbugs/bug013 +0.03 fixedbugs/bug014 +0.02 fixedbugs/bug015 +0.02 fixedbugs/bug016 +0.03 fixedbugs/bug017 +0.00 fixedbugs/bug020 +0.03 fixedbugs/bug021 +0.02 fixedbugs/bug022 +0.03 fixedbugs/bug023 +0.03 fixedbugs/bug024 +0.03 fixedbugs/bug026 +0.14 fixedbugs/bug027 +0.03 fixedbugs/bug028 +0.02 fixedbugs/bug030 +0.03 fixedbugs/bug031 +0.02 fixedbugs/bug035 +0.00 fixedbugs/bug036 +0.02 fixedbugs/bug037 +0.00 fixedbugs/bug038 +0.03 fixedbugs/bug039 +0.00 fixedbugs/bug040 +0.03 fixedbugs/bug045 +0.03 fixedbugs/bug046 +0.03 fixedbugs/bug047 +0.02 fixedbugs/bug048 +0.03 fixedbugs/bug049 +0.03 fixedbugs/bug050 +0.02 fixedbugs/bug051 +0.03 fixedbugs/bug052 +0.03 fixedbugs/bug053 +0.03 fixedbugs/bug054 +0.03 fixedbugs/bug055 +0.03 fixedbugs/bug056 +0.00 fixedbugs/bug057 +0.04 fixedbugs/bug058 +0.08 fixedbugs/bug059 +0.08 fixedbugs/bug060 +0.03 fixedbugs/bug061 +0.03 fixedbugs/bug062 +0.00 fixedbugs/bug063 +0.00 fixedbugs/bug064 +0.03 fixedbugs/bug065 +0.00 fixedbugs/bug066 +0.03 fixedbugs/bug067 +0.03 fixedbugs/bug068 +0.00 fixedbugs/bug069 +0.15 fixedbugs/bug070 +0.00 fixedbugs/bug071 +0.03 fixedbugs/bug072 +0.03 fixedbugs/bug073 +0.03 fixedbugs/bug074 +0.03 fixedbugs/bug075 +0.03 fixedbugs/bug076 +0.00 fixedbugs/bug077 +0.03 fixedbugs/bug078 +0.00 fixedbugs/bug080 +0.02 fixedbugs/bug081 +0.03 fixedbugs/bug082 +0.03 fixedbugs/bug083 +0.04 fixedbugs/bug084 +0.02 fixedbugs/bug085 +0.03 fixedbugs/bug086 +0.00 fixedbugs/bug087 +0.01 fixedbugs/bug088 +0.00 fixedbugs/bug089 +0.03 fixedbugs/bug090 +0.02 fixedbugs/bug091 +0.03 fixedbugs/bug092 +0.03 fixedbugs/bug093 +0.00 fixedbugs/bug094 +0.00 fixedbugs/bug096 +0.03 fixedbugs/bug097 +0.00 fixedbugs/bug098 +0.03 fixedbugs/bug099 +0.03 fixedbugs/bug101 +0.03 fixedbugs/bug102 +0.02 fixedbugs/bug103 +0.03 fixedbugs/bug104 +0.01 fixedbugs/bug106 +0.03 fixedbugs/bug107 +0.03 fixedbugs/bug108 +0.00 fixedbugs/bug109 +0.03 fixedbugs/bug110 +0.03 fixedbugs/bug111 +0.00 fixedbugs/bug112 +0.03 fixedbugs/bug113 +0.03 fixedbugs/bug114 +0.00 fixedbugs/bug115 +0.03 fixedbugs/bug116 +0.02 fixedbugs/bug117 +0.00 fixedbugs/bug118 +0.03 fixedbugs/bug119 +0.11 fixedbugs/bug120 +0.02 fixedbugs/bug121 +0.03 fixedbugs/bug122 +0.03 fixedbugs/bug123 +0.02 fixedbugs/bug126 +0.02 fixedbugs/bug127 +0.03 fixedbugs/bug128 +0.01 fixedbugs/bug129 +0.08 fixedbugs/bug130 +0.02 fixedbugs/bug131 +0.02 fixedbugs/bug132 +0.03 fixedbugs/bug133 +0.00 fixedbugs/bug135 +0.02 fixedbugs/bug136 +0.00 fixedbugs/bug137 +0.00 fixedbugs/bug139 +0.00 fixedbugs/bug140 +0.07 fixedbugs/bug141 +0.03 fixedbugs/bug142 +0.00 fixedbugs/bug143 +0.00 fixedbugs/bug144 +0.00 fixedbugs/bug145 +0.03 fixedbugs/bug146 +0.06 fixedbugs/bug147 +0.03 fixedbugs/bug148 +0.00 fixedbugs/bug149 +0.00 fixedbugs/bug150 +0.00 fixedbugs/bug151 +0.03 fixedbugs/bug1515 +0.03 fixedbugs/bug152 +0.14 fixedbugs/bug154 +0.03 fixedbugs/bug155 +0.00 fixedbugs/bug156 +0.00 fixedbugs/bug157 +0.00 fixedbugs/bug158 +0.07 fixedbugs/bug159 +0.09 fixedbugs/bug160 +0.00 fixedbugs/bug161 +0.02 fixedbugs/bug163 +0.00 fixedbugs/bug164 +0.03 fixedbugs/bug165 +0.03 fixedbugs/bug167 +0.03 fixedbugs/bug168 +0.02 fixedbugs/bug169 +0.03 fixedbugs/bug170 +0.03 fixedbugs/bug171 +0.02 fixedbugs/bug172 +0.00 fixedbugs/bug173 +0.00 fixedbugs/bug174 +0.03 fixedbugs/bug175 +0.03 fixedbugs/bug176 +0.09 fixedbugs/bug177 +0.03 fixedbugs/bug178 +0.03 fixedbugs/bug179 +0.03 fixedbugs/bug180 +0.03 fixedbugs/bug181 +0.02 fixedbugs/bug182 +0.03 fixedbugs/bug183 +0.15 fixedbugs/bug184 +0.04 fixedbugs/bug185 +0.02 fixedbugs/bug186 +0.08 fixedbugs/bug187 +0.03 fixedbugs/bug188 +0.03 fixedbugs/bug189 +0.00 fixedbugs/bug190 +0.04 fixedbugs/bug191 +0.03 fixedbugs/bug192 +0.03 fixedbugs/bug193 +0.03 fixedbugs/bug194 +0.02 fixedbugs/bug195 +0.04 fixedbugs/bug196 +0.02 fixedbugs/bug197 +0.03 fixedbugs/bug198 +0.03 fixedbugs/bug199 +0.03 fixedbugs/bug200 +0.03 fixedbugs/bug201 +0.03 fixedbugs/bug202 +0.03 fixedbugs/bug203 +0.03 fixedbugs/bug204 +0.02 fixedbugs/bug205 +0.21 fixedbugs/bug206 +0.14 fixedbugs/bug207 +0.02 fixedbugs/bug208 +0.02 fixedbugs/bug209 +0.03 fixedbugs/bug211 +0.03 fixedbugs/bug212 +0.03 fixedbugs/bug213 +0.00 fixedbugs/bug214 +0.02 fixedbugs/bug215 +0.00 fixedbugs/bug216 +0.03 fixedbugs/bug217 +0.00 fixedbugs/bug218 +0.00 fixedbugs/bug219 +0.04 fixedbugs/bug221 +0.01 fixedbugs/bug222 +0.00 fixedbugs/bug223 +0.03 fixedbugs/bug224 +0.03 fixedbugs/bug225 +0.03 fixedbugs/bug227 +0.03 fixedbugs/bug228 +0.03 fixedbugs/bug229 +0.03 fixedbugs/bug230 +0.02 fixedbugs/bug231 +0.00 fixedbugs/bug232 +0.01 fixedbugs/bug233 +0.04 fixedbugs/bug234 +0.00 fixedbugs/bug235 +0.04 fixedbugs/bug236 +0.15 fixedbugs/bug237 +0.03 fixedbugs/bug238 +0.00 fixedbugs/bug239 +0.03 fixedbugs/bug240 +0.03 fixedbugs/bug241 +0.04 fixedbugs/bug242 +0.04 fixedbugs/bug243 +0.03 fixedbugs/bug244 +0.00 fixedbugs/bug245 +0.03 fixedbugs/bug246 +0.03 fixedbugs/bug247 +0.11 fixedbugs/bug248 +0.03 fixedbugs/bug249 +0.00 fixedbugs/bug250 +0.03 fixedbugs/bug251 +0.03 fixedbugs/bug252 +0.03 fixedbugs/bug253 +0.03 fixedbugs/bug254 +0.03 fixedbugs/bug255 +0.03 fixedbugs/bug256 +0.47 fixedbugs/bug257 +0.14 fixedbugs/bug258 +0.16 fixedbugs/bug259 +0.16 fixedbugs/bug260 +0.03 fixedbugs/bug261 +0.10 fixedbugs/bug262 +0.03 fixedbugs/bug263 +0.03 fixedbugs/bug264 +0.07 fixedbugs/bug265 +0.03 fixedbugs/bug266 +0.00 fixedbugs/bug267 +0.03 fixedbugs/bug269 +0.13 fixedbugs/bug271 +0.02 fixedbugs/bug272 +0.04 fixedbugs/bug273 +0.02 fixedbugs/bug274 +0.00 fixedbugs/bug275 +0.03 fixedbugs/bug276 +0.00 fixedbugs/bug277 +0.03 fixedbugs/bug278 +0.04 fixedbugs/bug279 +0.02 fixedbugs/bug280 +0.04 fixedbugs/bug281 +0.00 fixedbugs/bug282 +0.00 fixedbugs/bug283 +0.03 fixedbugs/bug284 +0.05 fixedbugs/bug285 +0.04 fixedbugs/bug286 +0.02 fixedbugs/bug287 +0.00 fixedbugs/bug288 +0.02 fixedbugs/bug289 +0.04 fixedbugs/bug290 +0.04 fixedbugs/bug291 +0.03 fixedbugs/bug292 +0.04 fixedbugs/bug293 +0.03 fixedbugs/bug294 +0.16 fixedbugs/bug295 +0.04 fixedbugs/bug296 +0.03 fixedbugs/bug297 +0.03 fixedbugs/bug298 +0.03 fixedbugs/bug299 +0.03 fixedbugs/bug300 +0.00 fixedbugs/bug301 +0.04 fixedbugs/bug302 +0.05 fixedbugs/bug303 +0.00 fixedbugs/bug304 +0.03 fixedbugs/bug305 +0.01 fixedbugs/bug306 +0.00 fixedbugs/bug307 +0.01 fixedbugs/bug308 +0.00 fixedbugs/bug309 +0.04 fixedbugs/bug311 +0.03 fixedbugs/bug312 +0.04 fixedbugs/bug313 +0.04 fixedbugs/bug314 +0.00 fixedbugs/bug315 +0.00 fixedbugs/bug316 +0.03 fixedbugs/bug317 +0.03 fixedbugs/bug318 +0.00 fixedbugs/bug319 +0.03 fixedbugs/bug320 +0.14 fixedbugs/bug321 +0.04 fixedbugs/bug322 +0.03 fixedbugs/bug323 +0.04 fixedbugs/bug324 +0.03 fixedbugs/bug325 +0.02 fixedbugs/bug326 +0.04 fixedbugs/bug327 +0.03 fixedbugs/bug328 +0.04 fixedbugs/bug329 +0.02 fixedbugs/bug330 +0.04 fixedbugs/bug331 +0.02 fixedbugs/bug332 +0.03 fixedbugs/bug333 +0.01 fixedbugs/bug334 +0.01 fixedbugs/bug335 +0.04 fixedbugs/bug336 +0.03 fixedbugs/bug337 +0.00 fixedbugs/bug338 +0.03 fixedbugs/bug339 +0.02 fixedbugs/bug340 +0.03 fixedbugs/bug341 +0.02 fixedbugs/bug342 +0.04 fixedbugs/bug343 +0.02 fixedbugs/bug344 +0.03 fixedbugs/bug345 +0.08 fixedbugs/bug346 +0.04 fixedbugs/bug347 +0.06 fixedbugs/bug348 +0.03 fixedbugs/bug349 +0.03 fixedbugs/bug350 +0.02 fixedbugs/bug351 +0.03 fixedbugs/bug352 +0.03 fixedbugs/bug353 +0.00 fixedbugs/bug354 +0.03 fixedbugs/bug355 +0.03 fixedbugs/bug356 +0.02 fixedbugs/bug357 +0.04 fixedbugs/bug358 +0.00 fixedbugs/bug361 +0.03 fixedbugs/bug362 +0.03 fixedbugs/bug363 +0.15 fixedbugs/bug364 +0.02 fixedbugs/bug365 +0.03 fixedbugs/bug366 +0.03 fixedbugs/bug367 +0.03 fixedbugs/bug368 +0.51 fixedbugs/bug369 +0.03 fixedbugs/bug370 +0.02 fixedbugs/bug371 +0.03 fixedbugs/bug372 +0.03 fixedbugs/bug373 +0.03 fixedbugs/bug374 +0.03 fixedbugs/bug375 +0.03 fixedbugs/bug376 +0.01 fixedbugs/bug377 +0.03 fixedbugs/bug378 +0.02 fixedbugs/bug379 +0.00 fixedbugs/bug380 +0.03 fixedbugs/bug381 +0.01 fixedbugs/bug382 +0.03 fixedbugs/bug383 +0.03 fixedbugs/bug384 +0.00 fixedbugs/bug385_32 +0.03 fixedbugs/bug385_64 +0.03 fixedbugs/bug386 +0.01 fixedbugs/bug387 +0.02 fixedbugs/bug388 +0.03 fixedbugs/bug389 +0.03 fixedbugs/bug390 +0.00 fixedbugs/bug391 +0.01 fixedbugs/bug392 +0.00 fixedbugs/bug393 +0.03 fixedbugs/bug394 +0.00 fixedbugs/bug395 +0.01 fixedbugs/bug396 diff --git a/gcc/testsuite/go.test/test/turing.go b/gcc/testsuite/go.test/test/turing.go index 0af39de8b20..366982e67f1 100644 --- a/gcc/testsuite/go.test/test/turing.go +++ b/gcc/testsuite/go.test/test/turing.go @@ -10,42 +10,47 @@ package main var p, pc int var a [30000]byte + const prog = "++++++++++[>+++++++>++++++++++>+++>+<<<<-]>++.>+.+++++++..+++.>++.<<+++++++++++++++.>.+++.------.--------.>+.>.!" func scan(dir int) { for nest := dir; dir*nest > 0; pc += dir { switch prog[pc+dir] { - case ']': - nest-- - case '[': - nest++ + case ']': + nest-- + case '[': + nest++ } } } func main() { + r := "" for { switch prog[pc] { - case '>': - p++ - case '<': - p-- - case '+': - a[p]++ - case '-': - a[p]-- - case '.': - print(string(a[p])) - case '[': - if a[p] == 0 { - scan(1) - } - case ']': - if a[p] != 0 { - scan(-1) - } - default: - return + case '>': + p++ + case '<': + p-- + case '+': + a[p]++ + case '-': + a[p]-- + case '.': + r += string(a[p]) + case '[': + if a[p] == 0 { + scan(1) + } + case ']': + if a[p] != 0 { + scan(-1) + } + default: + if r != "Hello World!\n" { + panic(r) + } + return } pc++ } diff --git a/gcc/testsuite/go.test/test/typeswitch2.go b/gcc/testsuite/go.test/test/typeswitch2.go index f8fe396eae3..3e3acdae377 100644 --- a/gcc/testsuite/go.test/test/typeswitch2.go +++ b/gcc/testsuite/go.test/test/typeswitch2.go @@ -18,11 +18,27 @@ func whatis(x interface{}) string { return "Reader1" case io.Reader: // ERROR "duplicate" return "Reader2" - case interface { r(); w() }: + case interface { + r() + w() + }: return "rw" - case interface { w(); r() }: // ERROR "duplicate" + case interface { // GCCGO_ERROR "duplicate" + w() + r() + }: // GC_ERROR "duplicate" return "wr" - + } return "" } + +func notused(x interface{}) { + // The first t is in a different scope than the 2nd t; it cannot + // be accessed (=> declared and not used error); but it is legal + // to declare it. + switch t := 0; t := x.(type) { // ERROR "declared and not used" + case int: + _ = t // this is using the t of "t := x.(type)" + } +} diff --git a/gcc/testsuite/go.test/test/typeswitch3.go b/gcc/testsuite/go.test/test/typeswitch3.go new file mode 100644 index 00000000000..99d08a20f77 --- /dev/null +++ b/gcc/testsuite/go.test/test/typeswitch3.go @@ -0,0 +1,20 @@ +// errchk $G -e $D/$F.go + +// Copyright 2011 The Go Authors. All rights reserved. +// Use of this source code is governed by a BSD-style +// license that can be found in the LICENSE file. + +package main + + +type I interface { + M() +} + +func main(){ + var x I + switch x.(type) { + case string: // ERROR "impossible" + println("FAIL") + } +} diff --git a/gcc/testsuite/go.test/test/zerodivide.go b/gcc/testsuite/go.test/test/zerodivide.go index 1948528d245..3b08e774cc1 100644 --- a/gcc/testsuite/go.test/test/zerodivide.go +++ b/gcc/testsuite/go.test/test/zerodivide.go @@ -9,13 +9,10 @@ package main import ( "fmt" "math" + "runtime" "strings" ) -type Error interface { - String() string -} - type ErrorTest struct { name string fn func() @@ -161,10 +158,10 @@ var errorTests = []ErrorTest{ ErrorTest{"complex128 1/0", func() { use(e128 / d128) }, ""}, } -func error(fn func()) (error string) { +func error_(fn func()) (error string) { defer func() { if e := recover(); e != nil { - error = e.(Error).String() + error = e.(runtime.Error).Error() } }() fn() @@ -199,7 +196,7 @@ func main() { if t.err != "" { continue } - err := error(t.fn) + err := error_(t.fn) switch { case t.err == "" && err == "": // fine |